Incidental Mutation 'R1962:Piezo2'
ID217046
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Namepiezo-type mechanosensitive ion channel component 2
SynonymsFam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 039976-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1962 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location63010213-63387183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63078840 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1291 (M1291I)
Ref Sequence ENSEMBL: ENSMUSP00000138758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: M1305I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: M1305I

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182233
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183217
AA Change: M1291I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: M1291I

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,341,245 I354M probably damaging Het
Abca8a T C 11: 110,026,905 probably null Het
Abca8b T C 11: 109,979,898 R143G probably benign Het
Actn4 T C 7: 28,894,622 D840G probably damaging Het
Agpat5 T C 8: 18,878,010 L197P probably damaging Het
Akr1d1 T C 6: 37,536,048 V93A probably benign Het
Arap2 T C 5: 62,676,664 K820R possibly damaging Het
Armc9 T A 1: 86,207,974 C551S probably damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Brms1 C T 19: 5,045,999 R34W probably damaging Het
Cbx2 A G 11: 119,028,569 Q320R possibly damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Ccdc30 C T 4: 119,339,791 R426Q probably benign Het
Cdc42bpg T A 19: 6,306,855 V47E probably damaging Het
Cep170b C T 12: 112,738,061 S751L probably damaging Het
Cfap46 A T 7: 139,667,041 L328Q probably damaging Het
Crtc3 A G 7: 80,589,931 F558L probably damaging Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
Dchs1 A G 7: 105,764,201 Y1136H probably damaging Het
Dhrs4 T C 14: 55,487,603 V185A probably damaging Het
Dnah7b A G 1: 46,242,103 K2775E possibly damaging Het
Dst C A 1: 34,191,016 S2238R possibly damaging Het
Duox2 T C 2: 122,297,372 probably null Het
Dusp16 G T 6: 134,718,136 Y577* probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eml5 A G 12: 98,876,311 F176S probably damaging Het
Esco2 C A 14: 65,831,533 R109S probably damaging Het
Galnt7 C T 8: 57,532,714 E541K probably benign Het
Gbf1 C T 19: 46,267,219 T707I probably damaging Het
Gdf5 A G 2: 155,941,752 C427R probably damaging Het
Glyctk T C 9: 106,157,865 M1V probably null Het
Gm5478 T C 15: 101,644,395 E367G probably damaging Het
Gm9268 T C 7: 43,047,400 V620A probably benign Het
Golga7b G A 19: 42,263,329 V5I probably benign Het
Gpt2 T C 8: 85,493,135 L70P probably damaging Het
Gsdmc3 C A 15: 63,858,466 Q416H probably damaging Het
Hoxb5 A G 11: 96,304,092 E160G probably benign Het
Ift81 A T 5: 122,560,709 Y532N probably benign Het
Igf1 G A 10: 87,864,864 C66Y probably damaging Het
Igf1r T C 7: 68,207,275 V995A probably damaging Het
Ip6k1 T C 9: 108,041,088 probably null Het
Jaml T C 9: 45,104,197 I333T possibly damaging Het
Kdm4c T C 4: 74,307,016 probably benign Het
Kdm6b T C 11: 69,401,365 probably benign Het
Krt6a C T 15: 101,691,465 R404H probably damaging Het
Larp4b C A 13: 9,136,842 H69N probably benign Het
Lcat A T 8: 105,941,723 W222R probably damaging Het
Lrrc40 T A 3: 158,040,449 C54S probably benign Het
Mcpt9 T A 14: 56,027,567 H159L probably benign Het
Megf8 T C 7: 25,363,551 V2444A probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Micalcl A T 7: 112,412,844 I634L probably benign Het
Mov10 C T 3: 104,796,977 R835Q probably damaging Het
Mybpc1 A T 10: 88,548,826 L546Q probably damaging Het
Myo6 T C 9: 80,260,835 V427A probably damaging Het
Myom2 T A 8: 15,132,599 probably null Het
Mzt2 G A 16: 15,848,679 R125C probably damaging Het
Neb T A 2: 52,272,937 R2031* probably null Het
Nphp3 T C 9: 104,021,338 S447P probably benign Het
Nrp2 T A 1: 62,718,931 D25E probably benign Het
Nts A G 10: 102,485,057 L57S probably damaging Het
Nudt9 G A 5: 104,065,105 R348H probably benign Het
Olfr1299 T C 2: 111,664,889 I221T probably damaging Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Olfr211 C T 6: 116,493,764 P52S probably benign Het
Olfr401 C A 11: 74,121,824 D178E probably benign Het
Olfr976 T C 9: 39,956,683 Y84C probably benign Het
Pafah1b1 T C 11: 74,699,351 probably benign Het
Pik3ca T C 3: 32,443,867 F486S probably benign Het
Podnl1 C T 8: 84,127,297 H99Y probably benign Het
Prdm6 A T 18: 53,568,161 Y341F probably damaging Het
Prr5l C T 2: 101,758,509 probably null Het
Psmd4 G T 3: 95,036,701 T24N possibly damaging Het
Rbbp8nl G A 2: 180,280,874 T242M probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Scfd1 T C 12: 51,422,986 V438A probably benign Het
Scn9a A G 2: 66,484,311 C1677R probably damaging Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Shank1 T A 7: 44,344,323 probably null Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Sncaip C T 18: 52,871,362 H354Y probably damaging Het
St8sia2 T A 7: 73,943,309 D333V probably damaging Het
Stxbp2 C A 8: 3,642,672 R575S probably benign Het
Syt9 T A 7: 107,425,107 V69D probably damaging Het
Tanc2 A G 11: 105,798,732 N240S probably benign Het
Tcl1b1 T C 12: 105,164,468 L70S probably benign Het
Tmem44 C T 16: 30,543,401 probably null Het
Tor1b A G 2: 30,956,919 R293G probably benign Het
Trim29 T C 9: 43,311,318 V148A probably benign Het
Trmt10b C A 4: 45,314,378 Y271* probably null Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Ubqln5 T C 7: 104,128,927 D230G probably damaging Het
Ugt2b37 A G 5: 87,254,334 F146S probably damaging Het
Vmn1r160 T A 7: 22,871,402 V60E probably damaging Het
Vmn2r109 T A 17: 20,553,923 D390V probably damaging Het
Vmn2r27 C T 6: 124,223,834 R388Q possibly damaging Het
Vmn2r72 A T 7: 85,749,161 V537D probably benign Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Vmn2r98 C A 17: 19,065,333 Y138* probably null Het
Xrra1 A C 7: 99,911,020 E401A probably damaging Het
Zfp280d T A 9: 72,335,080 C688* probably null Het
Zfp3 T A 11: 70,772,128 Y304* probably null Het
Zfp407 A T 18: 84,559,336 D1217E probably benign Het
Zfp658 T C 7: 43,573,821 Y507H possibly damaging Het
Zfyve16 T C 13: 92,522,744 T220A possibly damaging Het
Zmym4 C G 4: 126,902,670 K820N possibly damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63017519 splice site probably null
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63053010 missense probably benign 0.01
R7612:Piezo2 UTSW 18 63042539 missense probably benign 0.12
R7829:Piezo2 UTSW 18 63113876 critical splice donor site probably null
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATGCAATCAGCCAGTCCCAG -3'
(R):5'- CCACTTACCTATTTGTCTAGGACTG -3'

Sequencing Primer
(F):5'- TCCCAGTAACGAAGGATGCTCTTG -3'
(R):5'- CTAGGACTGATTATGTAGGGGCTTCC -3'
Posted On2014-08-01