Incidental Mutation 'R1964:Rgl1'
ID217058
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Nameral guanine nucleotide dissociation stimulator,-like 1
SynonymsRgl
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location152516760-152766351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152549104 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 375 (I375F)
Ref Sequence ENSEMBL: ENSMUSP00000107490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]
Predicted Effect probably damaging
Transcript: ENSMUST00000027760
AA Change: I340F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: I340F

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111857
AA Change: I338F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: I338F

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111859
AA Change: I375F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: I375F

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188395
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Abca6 T A 11: 110,184,676 I1330F probably damaging Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Cul4a G A 8: 13,136,406 M505I possibly damaging Het
Cul4a T C 8: 13,136,854 M530T probably benign Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itga5 A G 15: 103,354,314 L309P probably damaging Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mapk9 C A 11: 49,854,333 R25S probably null Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Smgc G A 15: 91,860,270 G239D probably damaging Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tln2 T C 9: 67,342,135 D890G probably benign Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vcan A G 13: 89,692,742 V1561A probably benign Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152571617 missense probably benign 0.02
IGL01065:Rgl1 APN 1 152519142 missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152571588 splice site probably benign
IGL01726:Rgl1 APN 1 152519153 missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152549150 missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152528469 splice site probably benign
IGL02369:Rgl1 APN 1 152533606 missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152554424 unclassified probably benign
R0255:Rgl1 UTSW 1 152552596 missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152539945 missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152536265 critical splice donor site probably null
R0734:Rgl1 UTSW 1 152554300 missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152544433 missense probably benign 0.14
R1522:Rgl1 UTSW 1 152586533 missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152675023 splice site probably benign
R1634:Rgl1 UTSW 1 152524772 missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R2291:Rgl1 UTSW 1 152536281 missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152536289 missense probably benign 0.13
R4668:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4669:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152524699 nonsense probably null
R4830:Rgl1 UTSW 1 152554330 missense probably benign 0.11
R4853:Rgl1 UTSW 1 152557574 missense probably benign 0.07
R4969:Rgl1 UTSW 1 152549062 splice site probably null
R5778:Rgl1 UTSW 1 152552421 missense probably benign 0.05
R5979:Rgl1 UTSW 1 152557493 missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152519172 missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152586570 missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152552435 missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152524724 missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152533530 missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152539940 missense probably benign 0.00
R7290:Rgl1 UTSW 1 152544395 missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152519163 missense probably damaging 1.00
R7610:Rgl1 UTSW 1 152552620 missense probably damaging 1.00
R7774:Rgl1 UTSW 1 152554350 missense probably benign
RF005:Rgl1 UTSW 1 152521363 missense probably benign
Z1088:Rgl1 UTSW 1 152675020 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGTACACACAGAGGGTTTCAAC -3'
(R):5'- GGGAACAAGCTTACAGTGCC -3'

Sequencing Primer
(F):5'- AACCATGTTTCCCCTGTCACATG -3'
(R):5'- AAGGAGCCACTTTTTGATGTCCAG -3'
Posted On2014-08-01