Incidental Mutation 'R1964:Rif1'
ID 217063
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms D2Ertd145e, 6530403D07Rik, 5730435J01Rik
MMRRC Submission 039977-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1964 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 51962844-52012395 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 51988421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 720 (T720I)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069794
AA Change: T720I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: T720I

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112693
AA Change: T720I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: T720I

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,211,324 (GRCm39) H158Y probably damaging Het
1810009J06Rik T A 6: 40,945,141 (GRCm39) C207S probably damaging Het
Aadac T A 3: 59,944,759 (GRCm39) probably null Het
Abca6 T A 11: 110,075,502 (GRCm39) I1330F probably damaging Het
Adar A T 3: 89,653,202 (GRCm39) S263C probably benign Het
Adra2b T C 2: 127,205,734 (GRCm39) Y84H probably damaging Het
Arnt2 A T 7: 83,992,997 (GRCm39) V181E possibly damaging Het
Atg7 T C 6: 114,683,191 (GRCm39) L418P probably damaging Het
Atp2c1 A G 9: 105,323,322 (GRCm39) L181P probably damaging Het
Awat2 G A X: 99,448,165 (GRCm39) P148S probably damaging Het
Birc6 A G 17: 74,941,880 (GRCm39) M2737V possibly damaging Het
Ccdc81 A G 7: 89,535,361 (GRCm39) C292R probably benign Het
Cd14 T A 18: 36,859,392 (GRCm39) E21V probably damaging Het
Cdc14b A C 13: 64,363,351 (GRCm39) C303W probably damaging Het
Cdh23 T C 10: 60,221,001 (GRCm39) I1248V probably benign Het
Ceacam1 T C 7: 25,174,133 (GRCm39) D174G probably benign Het
Cgas T G 9: 78,344,737 (GRCm39) Y228S probably damaging Het
Chd7 A G 4: 8,865,978 (GRCm39) M717V probably damaging Het
Cib1 T C 7: 79,882,120 (GRCm39) T20A possibly damaging Het
Clec4d A G 6: 123,239,319 (GRCm39) K9R probably benign Het
Cntnap1 C A 11: 101,068,850 (GRCm39) S131* probably null Het
Crybg1 T C 10: 43,834,326 (GRCm39) K1581R probably damaging Het
Csf2 T G 11: 54,139,284 (GRCm39) T100P probably benign Het
Csrp2 T A 10: 110,767,894 (GRCm39) D26E probably benign Het
Cul1 T C 6: 47,479,505 (GRCm39) V257A probably damaging Het
Cul4a G A 8: 13,186,406 (GRCm39) M505I possibly damaging Het
Cul4a T C 8: 13,186,854 (GRCm39) M530T probably benign Het
Dcp2 T C 18: 44,529,038 (GRCm39) M51T possibly damaging Het
Ddx60 T A 8: 62,401,903 (GRCm39) C260S probably benign Het
Dennd2c G A 3: 103,073,807 (GRCm39) R851H probably damaging Het
Dnah11 T C 12: 118,106,027 (GRCm39) E625G possibly damaging Het
Edem1 T C 6: 108,821,908 (GRCm39) W322R probably benign Het
Egflam T C 15: 7,276,586 (GRCm39) T527A probably damaging Het
Ephb1 T A 9: 101,848,322 (GRCm39) M659L possibly damaging Het
Fbxl2 A G 9: 113,818,237 (GRCm39) I203T probably benign Het
Gabbr1 G A 17: 37,359,351 (GRCm39) G109R probably damaging Het
Gabra2 T C 5: 71,171,793 (GRCm39) I148V possibly damaging Het
Golga1 A G 2: 38,937,099 (GRCm39) V161A probably benign Het
Gps2 T G 11: 69,807,246 (GRCm39) S301A probably benign Het
H2-D1 T C 17: 35,482,595 (GRCm39) L105P probably benign Het
Igdcc4 T C 9: 65,030,051 (GRCm39) V367A probably benign Het
Igkv4-69 T G 6: 69,260,782 (GRCm39) Y115S probably benign Het
Itga5 A G 15: 103,262,741 (GRCm39) L309P probably damaging Het
Itih1 A G 14: 30,651,580 (GRCm39) Y871H probably damaging Het
Itpr2 T A 6: 146,013,191 (GRCm39) N2662I probably damaging Het
Kctd19 T A 8: 106,115,102 (GRCm39) E486D probably damaging Het
Kif5b C T 18: 6,209,059 (GRCm39) R901Q possibly damaging Het
Kmt2a G A 9: 44,731,941 (GRCm39) S2792F probably benign Het
Magi3 A G 3: 103,927,718 (GRCm39) V1023A probably damaging Het
Mapk9 C A 11: 49,745,160 (GRCm39) R25S probably null Het
Memo1 T C 17: 74,552,003 (GRCm39) T98A possibly damaging Het
Mill2 A G 7: 18,590,529 (GRCm39) K203R probably damaging Het
Mios T A 6: 8,215,798 (GRCm39) H331Q probably damaging Het
Muc6 G T 7: 141,226,329 (GRCm39) S1566* probably null Het
Muc6 A G 7: 141,226,330 (GRCm39) probably benign Het
Napsa T C 7: 44,231,109 (GRCm39) F113L probably benign Het
Or5ac16 T A 16: 59,022,271 (GRCm39) I173F possibly damaging Het
Or9m1 A G 2: 87,734,011 (GRCm39) V3A probably benign Het
Oscp1 T G 4: 125,977,415 (GRCm39) V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 (GRCm39) S421R probably damaging Het
Pclaf A G 9: 65,800,677 (GRCm39) N50D probably damaging Het
Pdgfc A T 3: 81,082,292 (GRCm39) I162F probably benign Het
Plag1 T C 4: 3,903,956 (GRCm39) T412A probably benign Het
Pogz A T 3: 94,785,504 (GRCm39) T820S probably benign Het
Ptpn9 T A 9: 56,967,196 (GRCm39) V473D probably damaging Het
Qdpr A T 5: 45,596,660 (GRCm39) M66K possibly damaging Het
Qrich1 A G 9: 108,411,621 (GRCm39) N382S possibly damaging Het
Rbbp8 T C 18: 11,875,736 (GRCm39) V883A possibly damaging Het
Rgl1 T A 1: 152,424,855 (GRCm39) I375F probably damaging Het
Rilp A T 11: 75,401,328 (GRCm39) Q95L probably benign Het
Rnf169 T A 7: 99,574,732 (GRCm39) N621I probably damaging Het
Rps27a T C 11: 29,497,229 (GRCm39) K27R probably null Het
Sar1a T C 10: 61,520,947 (GRCm39) V54A probably benign Het
Sash1 T A 10: 8,605,477 (GRCm39) H971L probably benign Het
Sdk2 G A 11: 113,671,843 (GRCm39) Q2102* probably null Het
Serpina1e T A 12: 103,917,466 (GRCm39) I68F probably damaging Het
Serpinb9e A C 13: 33,437,474 (GRCm39) Q119P probably benign Het
Sh3tc2 A T 18: 62,124,226 (GRCm39) K965* probably null Het
Slc16a1 A T 3: 104,556,782 (GRCm39) S56C probably damaging Het
Slc26a11 T A 11: 119,271,020 (GRCm39) L563Q possibly damaging Het
Smarca2 G T 19: 26,650,124 (GRCm39) E24* probably null Het
Smgc G A 15: 91,744,468 (GRCm39) G239D probably damaging Het
Sos2 A T 12: 69,663,636 (GRCm39) M616K possibly damaging Het
Tet1 T A 10: 62,648,726 (GRCm39) D1902V possibly damaging Het
Thap2 C T 10: 115,220,152 (GRCm39) C10Y probably damaging Het
Tln2 T C 9: 67,249,417 (GRCm39) D890G probably benign Het
Tor2a G A 2: 32,648,716 (GRCm39) G62D probably damaging Het
Ubqln5 A T 7: 103,778,095 (GRCm39) V243E possibly damaging Het
Utrn A T 10: 12,560,181 (GRCm39) D1369E probably damaging Het
Vcan A G 13: 89,840,861 (GRCm39) V1561A probably benign Het
Vmn1r70 T C 7: 10,367,737 (GRCm39) F56S possibly damaging Het
Vmn2r25 A G 6: 123,800,254 (GRCm39) L696S possibly damaging Het
Washc2 A G 6: 116,185,948 (GRCm39) T53A probably damaging Het
Wnk1 T A 6: 119,911,343 (GRCm39) T2417S possibly damaging Het
Zbtb49 A T 5: 38,361,105 (GRCm39) C12* probably null Het
Zfp472 C A 17: 33,196,848 (GRCm39) P308T possibly damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52,011,019 (GRCm39) missense probably damaging 0.96
IGL00711:Rif1 APN 2 52,001,082 (GRCm39) missense probably benign 0.00
IGL00721:Rif1 APN 2 52,009,129 (GRCm39) missense probably damaging 1.00
IGL01085:Rif1 APN 2 51,975,152 (GRCm39) missense possibly damaging 0.71
IGL01093:Rif1 APN 2 51,985,960 (GRCm39) missense probably damaging 1.00
IGL01107:Rif1 APN 2 52,001,315 (GRCm39) missense probably benign 0.00
IGL01138:Rif1 APN 2 52,001,534 (GRCm39) missense probably damaging 1.00
IGL01844:Rif1 APN 2 52,002,555 (GRCm39) missense probably benign 0.07
IGL02441:Rif1 APN 2 51,995,527 (GRCm39) missense probably benign 0.00
IGL02448:Rif1 APN 2 52,006,708 (GRCm39) missense probably damaging 0.99
IGL02563:Rif1 APN 2 51,967,077 (GRCm39) missense probably damaging 1.00
IGL02704:Rif1 APN 2 51,983,588 (GRCm39) missense probably damaging 1.00
IGL02946:Rif1 APN 2 52,000,137 (GRCm39) nonsense probably null
IGL03060:Rif1 APN 2 52,002,149 (GRCm39) missense probably damaging 0.97
IGL03206:Rif1 APN 2 51,993,634 (GRCm39) missense probably damaging 1.00
IGL03263:Rif1 APN 2 51,980,273 (GRCm39) missense probably damaging 0.99
IGL03267:Rif1 APN 2 51,967,000 (GRCm39) missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52,002,611 (GRCm39) missense probably benign 0.32
hifi UTSW 2 52,000,336 (GRCm39) unclassified probably benign
nietzsche UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52,001,970 (GRCm39) missense
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0104:Rif1 UTSW 2 52,000,104 (GRCm39) missense possibly damaging 0.77
R0268:Rif1 UTSW 2 51,980,298 (GRCm39) critical splice donor site probably null
R0276:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0278:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0288:Rif1 UTSW 2 52,000,025 (GRCm39) missense probably damaging 1.00
R0314:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0345:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0346:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0383:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R0384:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0387:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0388:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0456:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0477:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0505:Rif1 UTSW 2 52,000,749 (GRCm39) missense probably damaging 0.99
R0510:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0511:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0633:Rif1 UTSW 2 52,002,575 (GRCm39) missense probably benign 0.00
R0637:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0638:Rif1 UTSW 2 52,001,600 (GRCm39) missense probably benign 0.12
R0666:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0675:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0707:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0726:Rif1 UTSW 2 52,000,365 (GRCm39) missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0744:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0938:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0939:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0940:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0941:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0942:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0943:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1006:Rif1 UTSW 2 51,975,041 (GRCm39) missense probably damaging 0.99
R1052:Rif1 UTSW 2 52,001,574 (GRCm39) missense probably benign 0.01
R1061:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1175:Rif1 UTSW 2 51,997,640 (GRCm39) unclassified probably benign
R1183:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1184:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1271:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1332:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1336:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1351:Rif1 UTSW 2 52,001,567 (GRCm39) missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1527:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1560:Rif1 UTSW 2 52,001,143 (GRCm39) missense probably damaging 1.00
R1563:Rif1 UTSW 2 51,963,235 (GRCm39) missense probably damaging 0.99
R1571:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1625:Rif1 UTSW 2 51,993,652 (GRCm39) missense probably benign 0.25
R1679:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1689:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1731:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1744:Rif1 UTSW 2 52,002,404 (GRCm39) missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1748:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1831:Rif1 UTSW 2 51,968,507 (GRCm39) nonsense probably null
R1902:Rif1 UTSW 2 52,006,685 (GRCm39) missense possibly damaging 0.93
R1978:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2000:Rif1 UTSW 2 51,971,310 (GRCm39) missense probably damaging 0.99
R2030:Rif1 UTSW 2 51,982,358 (GRCm39) missense probably damaging 1.00
R2056:Rif1 UTSW 2 51,983,588 (GRCm39) missense probably damaging 1.00
R2106:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2109:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2125:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2126:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2145:Rif1 UTSW 2 52,001,412 (GRCm39) missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2153:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2213:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2327:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2513:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2516:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2520:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2905:Rif1 UTSW 2 51,988,516 (GRCm39) missense probably damaging 0.99
R3005:Rif1 UTSW 2 51,972,776 (GRCm39) missense probably damaging 1.00
R3155:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3156:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3429:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3707:Rif1 UTSW 2 51,983,592 (GRCm39) missense probably damaging 1.00
R3907:Rif1 UTSW 2 52,002,557 (GRCm39) missense probably benign 0.03
R3978:Rif1 UTSW 2 52,006,759 (GRCm39) critical splice donor site probably null
R4023:Rif1 UTSW 2 52,011,099 (GRCm39) missense probably benign 0.01
R4052:Rif1 UTSW 2 51,988,483 (GRCm39) nonsense probably null
R4668:Rif1 UTSW 2 52,001,964 (GRCm39) missense probably benign 0.01
R4674:Rif1 UTSW 2 51,996,954 (GRCm39) missense probably null 1.00
R4715:Rif1 UTSW 2 51,963,151 (GRCm39) utr 5 prime probably benign
R4766:Rif1 UTSW 2 51,988,946 (GRCm39) missense probably damaging 1.00
R4783:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4785:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4869:Rif1 UTSW 2 51,983,623 (GRCm39) intron probably benign
R4911:Rif1 UTSW 2 52,000,530 (GRCm39) missense probably damaging 0.98
R4951:Rif1 UTSW 2 51,974,998 (GRCm39) splice site probably null
R5044:Rif1 UTSW 2 51,999,940 (GRCm39) missense probably damaging 0.99
R5088:Rif1 UTSW 2 51,982,307 (GRCm39) missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52,010,321 (GRCm39) missense probably damaging 1.00
R5187:Rif1 UTSW 2 51,971,301 (GRCm39) missense probably damaging 1.00
R5222:Rif1 UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
R5243:Rif1 UTSW 2 52,001,836 (GRCm39) missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52,010,983 (GRCm39) intron probably benign
R5476:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
R5496:Rif1 UTSW 2 51,988,928 (GRCm39) missense probably damaging 1.00
R5641:Rif1 UTSW 2 52,011,170 (GRCm39) missense possibly damaging 0.80
R5883:Rif1 UTSW 2 51,995,651 (GRCm39) critical splice donor site probably null
R5987:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5990:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5992:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6019:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6020:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6255:Rif1 UTSW 2 51,975,065 (GRCm39) missense probably damaging 1.00
R6342:Rif1 UTSW 2 52,009,168 (GRCm39) missense probably damaging 0.97
R6364:Rif1 UTSW 2 51,997,681 (GRCm39) missense probably damaging 0.97
R6747:Rif1 UTSW 2 51,968,275 (GRCm39) splice site probably null
R6928:Rif1 UTSW 2 51,985,973 (GRCm39) missense probably damaging 1.00
R6954:Rif1 UTSW 2 52,002,703 (GRCm39) missense probably benign 0.00
R7003:Rif1 UTSW 2 51,967,001 (GRCm39) missense probably benign 0.06
R7310:Rif1 UTSW 2 51,995,631 (GRCm39) missense probably benign 0.12
R7549:Rif1 UTSW 2 51,968,519 (GRCm39) missense possibly damaging 0.52
R7603:Rif1 UTSW 2 51,966,187 (GRCm39) missense probably damaging 1.00
R7673:Rif1 UTSW 2 51,978,666 (GRCm39) missense probably damaging 1.00
R7741:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R7777:Rif1 UTSW 2 52,006,368 (GRCm39) missense probably benign 0.00
R7910:Rif1 UTSW 2 51,968,399 (GRCm39) nonsense probably null
R7962:Rif1 UTSW 2 51,964,288 (GRCm39) missense probably damaging 1.00
R8264:Rif1 UTSW 2 51,980,290 (GRCm39) missense noncoding transcript
R8390:Rif1 UTSW 2 52,000,935 (GRCm39) missense probably damaging 1.00
R8479:Rif1 UTSW 2 52,002,563 (GRCm39) missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52,001,011 (GRCm39) missense probably damaging 0.96
R8762:Rif1 UTSW 2 52,001,742 (GRCm39) missense
R8785:Rif1 UTSW 2 52,000,493 (GRCm39) missense probably benign 0.06
R8890:Rif1 UTSW 2 51,988,875 (GRCm39) missense probably damaging 0.99
R9081:Rif1 UTSW 2 52,000,989 (GRCm39) missense probably damaging 0.99
R9225:Rif1 UTSW 2 52,001,862 (GRCm39) missense probably benign 0.22
R9284:Rif1 UTSW 2 51,998,564 (GRCm39) missense probably benign 0.00
R9300:Rif1 UTSW 2 52,001,151 (GRCm39) missense probably damaging 1.00
R9366:Rif1 UTSW 2 52,010,356 (GRCm39) missense
R9477:Rif1 UTSW 2 52,001,342 (GRCm39) missense probably benign 0.02
R9522:Rif1 UTSW 2 51,971,311 (GRCm39) missense probably damaging 1.00
R9573:Rif1 UTSW 2 52,000,466 (GRCm39) missense probably benign 0.29
R9630:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
X0064:Rif1 UTSW 2 51,984,645 (GRCm39) missense probably damaging 0.96
X0064:Rif1 UTSW 2 51,964,327 (GRCm39) missense probably benign 0.00
Z1177:Rif1 UTSW 2 51,978,660 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAGGTCCCTCTGACAAGTG -3'
(R):5'- GCTCTATGTAGCACAAGGAAGG -3'

Sequencing Primer
(F):5'- CCTCTGACAAGTGAAGTGTGTCAC -3'
(R):5'- CGACTCACTGAAAGGACTT -3'
Posted On 2014-08-01