Mutagenetix > Incidental Mutations

Incidental Mutation 'R0132:Nin'

21707

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

038417-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0132 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 70051141 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 515 (K515T)

Ref Sequence

ENSEMBL: ENSMUSP00000152350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021468
AA Change: K515T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: K515T

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085314
AA Change: K515T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: K515T

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095666
AA Change: K515T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: K515T

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169074
AA Change: K515T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: K515T

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220689
AA Change: K515T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

probably damaging
Transcript: ENSMUST00000222237
AA Change: K515T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222835
AA Change: K515T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223257
AA Change: K515T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223316

Meta Mutation Damage Score

0.4087

Coding Region Coverage

1x: 99.1%
3x: 97.9%
10x: 94.2%
20x: 84.8%

Validation Efficiency

90% (52/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,137,615	R320G	probably damaging	Het
Abcc12	A	G	8: 86,531,568	I773T	probably benign	Het
Adamtsl1	T	A	4: 86,342,723	I1057N	possibly damaging	Het
Anxa5	G	A	3: 36,450,672	A247V	probably damaging	Het
Ascc3	T	G	10: 50,735,329	W1589G	probably damaging	Het
Atp2b2	G	A	6: 113,793,782	P389S	probably damaging	Het
Bpifa6	T	A	2: 153,982,931	S9T	probably benign	Het
Chd8	A	G	14: 52,205,326	V589A	probably benign	Het
Chrnb2	T	C	3: 89,764,406	M1V	probably null	Het
Col16a1	T	A	4: 130,067,096	V449E	unknown	Het
Cttnbp2nl	T	G	3: 105,005,857	K237T	probably damaging	Het
Dazap1	T	G	10: 80,278,226		probably null	Het
Fam187b	T	A	7: 30,989,120	V22E	probably damaging	Het
Gm4788	T	A	1: 139,754,271	T196S	probably damaging	Het
H2-T24	T	A	17: 36,014,986	I238F	probably damaging	Het
Hectd4	A	G	5: 121,333,024	E2658G	probably benign	Het
Herc1	A	C	9: 66,480,910	I3826L	probably benign	Het
Hinfp	A	G	9: 44,299,763	C67R	probably damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Hspg2	T	C	4: 137,551,887	Y3094H	probably damaging	Het
Htr1f	A	G	16: 64,926,728	V67A	probably damaging	Het
Iqcc	T	G	4: 129,616,599	E374D	probably damaging	Het
Kcnj9	T	C	1: 172,326,198	T120A	probably damaging	Het
Kitl	C	T	10: 100,087,364	P208S	probably benign	Het
Lpcat4	A	G	2: 112,246,748	Y479C	probably damaging	Het
Lrrc74b	T	C	16: 17,553,152	N227S	probably damaging	Het
Mdc1	T	A	17: 35,852,581	V1007D	probably damaging	Het
Mocos	T	G	18: 24,679,762	I571S	probably benign	Het
Myh8	A	G	11: 67,292,188	N659D	probably damaging	Het
Naip2	A	G	13: 100,183,788	V240A	probably benign	Het
Nap1l1	T	C	10: 111,485,509	S37P	probably benign	Het
Npl	T	A	1: 153,509,118	K258*	probably null	Het
Ntn4	T	A	10: 93,644,707	S98T	possibly damaging	Het
Olfr177	C	A	16: 58,872,906	M81I	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr417	T	C	1: 174,369,586	V223A	probably damaging	Het
Ppox	C	A	1: 171,279,275	A192S	possibly damaging	Het
Prkdc	T	C	16: 15,713,653	L1380S	probably benign	Het
Psd4	C	A	2: 24,405,351	A839E	probably damaging	Het
Ptprn2	T	G	12: 116,722,091	F57V	probably damaging	Het
Ptprt	C	T	2: 162,278,110	V146I	probably benign	Het
R3hdm2	T	A	10: 127,498,453	M915K	probably damaging	Het
Rab26	C	T	17: 24,530,785		probably null	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Rprd2	T	C	3: 95,774,361	K407E	probably damaging	Het
Siah3	G	A	14: 75,456,134	V27I	possibly damaging	Het
Slc14a2	T	A	18: 78,192,123	N280Y	probably damaging	Het
Slc25a35	A	G	11: 68,971,960	Y247C	probably damaging	Het
Slc29a4	A	G	5: 142,705,530	D55G	probably benign	Het
Slc35d1	C	T	4: 103,208,181	V189I	probably benign	Het
Srrm1	G	A	4: 135,340,573	R322*	probably null	Het
Stac3	A	T	10: 127,503,650	R138S	probably damaging	Het
Tmem260	T	A	14: 48,483,322	C306*	probably null	Het
Tspyl1	A	G	10: 34,283,089	N270S	probably damaging	Het
Ugt2a2	T	A	5: 87,474,861	K293*	probably null	Het
Vmn2r102	A	C	17: 19,678,763	T456P	probably benign	Het
Vmn2r90	T	A	17: 17,712,249	S139R	probably benign	Het
Zmym2	A	G	14: 56,943,258	N876D	probably benign	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- GCCAGCCTCTCCTCTTGAAGAAAG -3'
(R):5'- CAAGGACAGTCCCCTGATTTCTGAC -3'

Sequencing Primer
(F):5'- CTACTCAGCTAGTGTTCAGCTAGG -3'
(R):5'- AGTCCCCTGATTTCTGACTTTGTG -3'

Posted On

2013-04-11