Incidental Mutation 'R1964:Cul4a'
ID217104
Institutional Source Beutler Lab
Gene Symbol Cul4a
Ensembl Gene ENSMUSG00000031446
Gene Namecullin 4A
Synonyms2810470J21Rik
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13105621-13147940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13136406 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 505 (M505I)
Ref Sequence ENSEMBL: ENSMUSP00000016680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016680] [ENSMUST00000125514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016680
AA Change: M505I

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000016680
Gene: ENSMUSG00000031446
AA Change: M505I

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
SCOP:d1ldja2 61 401 1e-118 SMART
Blast:CULLIN 83 151 5e-9 BLAST
CULLIN 434 582 1.6e-76 SMART
Blast:CULLIN 585 640 7e-28 BLAST
Cullin_Nedd8 688 753 8.29e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125514
SMART Domains Protein: ENSMUSP00000123074
Gene: ENSMUSG00000031446

DomainStartEndE-ValueType
Pfam:Cullin 1 68 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185110
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CUL4A is the ubiquitin ligase component of a multimeric complex involved in the degradation of DNA damage-response proteins (Liu et al., 2009 [PubMed 19481525]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit reduced female fertility, male infertility, impaired spermatogenesis, and impaired DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Abca6 T A 11: 110,184,676 I1330F probably damaging Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itga5 A G 15: 103,354,314 L309P probably damaging Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mapk9 C A 11: 49,854,333 R25S probably null Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rgl1 T A 1: 152,549,104 I375F probably damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Smgc G A 15: 91,860,270 G239D probably damaging Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tln2 T C 9: 67,342,135 D890G probably benign Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vcan A G 13: 89,692,742 V1561A probably benign Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Cul4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Cul4a APN 8 13127735 missense probably benign 0.18
IGL00952:Cul4a APN 8 13146562 missense probably damaging 1.00
IGL01604:Cul4a APN 8 13133843 critical splice donor site probably null
IGL01688:Cul4a APN 8 13146571 nonsense probably null
IGL02167:Cul4a APN 8 13122826 missense probably damaging 1.00
IGL02927:Cul4a APN 8 13124861 missense possibly damaging 0.55
IGL03066:Cul4a APN 8 13133776 missense probably benign 0.22
R0183:Cul4a UTSW 8 13133790 missense probably damaging 0.98
R1600:Cul4a UTSW 8 13123954 missense probably damaging 1.00
R1860:Cul4a UTSW 8 13123565 missense probably damaging 1.00
R1865:Cul4a UTSW 8 13142589 missense possibly damaging 0.94
R1905:Cul4a UTSW 8 13133171 missense probably benign 0.06
R1964:Cul4a UTSW 8 13136854 missense probably benign 0.00
R2381:Cul4a UTSW 8 13136887 missense probably benign 0.45
R3787:Cul4a UTSW 8 13133668 missense probably damaging 0.99
R4006:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4007:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4748:Cul4a UTSW 8 13123526 missense probably benign 0.06
R5244:Cul4a UTSW 8 13146566 missense probably damaging 1.00
R6389:Cul4a UTSW 8 13140278 missense probably benign
R6736:Cul4a UTSW 8 13136219 missense probably benign 0.00
R7201:Cul4a UTSW 8 13142991 missense probably damaging 0.98
R7313:Cul4a UTSW 8 13121676 critical splice acceptor site probably benign
R7446:Cul4a UTSW 8 13136874 missense probably benign
R7485:Cul4a UTSW 8 13140279 missense possibly damaging 0.68
R7569:Cul4a UTSW 8 13123493 missense probably benign
X0026:Cul4a UTSW 8 13105871 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGAGAAGTCCATGCTGTCGAAG -3'
(R):5'- CAGTGCACTCAAGAAGAAATGATAC -3'

Sequencing Primer
(F):5'- TGTCGAAGCTCAAGCACG -3'
(R):5'- GGCTGGCTTTTAAACTAAGAGATCC -3'
Posted On2014-08-01