Incidental Mutation 'R0132:Chd8'
ID21711
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Namechromodomain helicase DNA binding protein 8
SynonymsDuplin, 5830451P18Rik
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0132 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location52198151-52257780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52205326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 589 (V589A)
Ref Sequence ENSEMBL: ENSMUSP00000122995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]
Predicted Effect probably benign
Transcript: ENSMUST00000089752
AA Change: V1929A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: V1929A

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147827
Predicted Effect probably benign
Transcript: ENSMUST00000149975
AA Change: V589A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: V589A

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Blast:DEXDc 112 235 9e-40 BLAST
low complexity region 239 250 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
low complexity region 430 445 N/A INTRINSIC
Blast:SANT 456 515 1e-29 BLAST
low complexity region 547 563 N/A INTRINSIC
low complexity region 723 767 N/A INTRINSIC
low complexity region 882 899 N/A INTRINSIC
BRK 972 1016 1.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180857
Predicted Effect probably benign
Transcript: ENSMUST00000200169
AA Change: V1929A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: V1929A

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227448
Predicted Effect probably benign
Transcript: ENSMUST00000227897
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 missense probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified probably benign
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.32
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.12
IGL01895:Chd8 APN 14 52199094 missense probably benign 0.00
IGL02090:Chd8 APN 14 52227234 critical splice donor site probably null
IGL02344:Chd8 APN 14 52201650 missense probably damaging 1.00
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 unclassified probably null
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 splice site probably benign
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52218249 missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52207996 missense probably benign
PIT4468001:Chd8 UTSW 14 52217881 missense possibly damaging 0.95
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.24
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0624:Chd8 UTSW 14 52219757 missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.09
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign 0.07
R0835:Chd8 UTSW 14 52204025 missense probably benign 0.07
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1838:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.25
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4154:Chd8 UTSW 14 52207211 unclassified probably benign
R4445:Chd8 UTSW 14 52204527 unclassified probably null
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.03
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.09
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron probably benign
R5348:Chd8 UTSW 14 52232698 missense probably damaging 1.00
R5375:Chd8 UTSW 14 52204154 missense probably damaging 1.00
R5470:Chd8 UTSW 14 52212609 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron probably benign
R5489:Chd8 UTSW 14 52213048 intron probably benign
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.16
R6212:Chd8 UTSW 14 52201698 missense probably damaging 1.00
R6337:Chd8 UTSW 14 52204109 missense probably damaging 1.00
R6394:Chd8 UTSW 14 52202585 missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6590:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52226668 missense probably benign 0.33
R6913:Chd8 UTSW 14 52214494 missense probably damaging 0.99
R7090:Chd8 UTSW 14 52215220 missense probably damaging 0.99
R7107:Chd8 UTSW 14 52212672 missense probably benign 0.07
R7138:Chd8 UTSW 14 52214498 missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52215319 missense probably damaging 1.00
R7392:Chd8 UTSW 14 52232855 missense probably benign
R7471:Chd8 UTSW 14 52204112 missense probably benign
R7625:Chd8 UTSW 14 52237077 missense probably benign 0.04
R7790:Chd8 UTSW 14 52226082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCTGAATCATCCTCGTCCTCC -3'
(R):5'- GTTGCAGAACCTCCAGACCCTAATC -3'

Sequencing Primer
(F):5'- TGTATCTGAAGAGCCTACGC -3'
(R):5'- AGACCCTAATCTGTTCATTGAGCC -3'
Posted On2013-04-11