Mutagenetix > Incidental Mutation

Incidental Mutation 'R0132:Chd8'

21711

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

038417-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0132 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52205326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 589 (V589A)

Ref Sequence

ENSEMBL: ENSMUSP00000122995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]

AlphaFold

Q09XV5

Predicted Effect

probably benign
Transcript: ENSMUST00000089752
AA Change: V1929A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: V1929A

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147827

Predicted Effect

probably benign
Transcript: ENSMUST00000149975
AA Change: V589A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: V589A

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

probably benign
Transcript: ENSMUST00000200169
AA Change: V1929A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: V1929A

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226681

Predicted Effect

probably benign
Transcript: ENSMUST00000227897

Meta Mutation Damage Score

0.1074

Coding Region Coverage

1x: 99.1%
3x: 97.9%
10x: 94.2%
20x: 84.8%

Validation Efficiency

90% (52/58)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,137,615	R320G	probably damaging	Het
Abcc12	A	G	8: 86,531,568	I773T	probably benign	Het
Adamtsl1	T	A	4: 86,342,723	I1057N	possibly damaging	Het
Anxa5	G	A	3: 36,450,672	A247V	probably damaging	Het
Ascc3	T	G	10: 50,735,329	W1589G	probably damaging	Het
Atp2b2	G	A	6: 113,793,782	P389S	probably damaging	Het
Bpifa6	T	A	2: 153,982,931	S9T	probably benign	Het
Chrnb2	T	C	3: 89,764,406	M1V	probably null	Het
Col16a1	T	A	4: 130,067,096	V449E	unknown	Het
Cttnbp2nl	T	G	3: 105,005,857	K237T	probably damaging	Het
Dazap1	T	G	10: 80,278,226		probably null	Het
Fam187b	T	A	7: 30,989,120	V22E	probably damaging	Het
Gm4788	T	A	1: 139,754,271	T196S	probably damaging	Het
H2-T24	T	A	17: 36,014,986	I238F	probably damaging	Het
Hectd4	A	G	5: 121,333,024	E2658G	probably benign	Het
Herc1	A	C	9: 66,480,910	I3826L	probably benign	Het
Hinfp	A	G	9: 44,299,763	C67R	probably damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Hspg2	T	C	4: 137,551,887	Y3094H	probably damaging	Het
Htr1f	A	G	16: 64,926,728	V67A	probably damaging	Het
Iqcc	T	G	4: 129,616,599	E374D	probably damaging	Het
Kcnj9	T	C	1: 172,326,198	T120A	probably damaging	Het
Kitl	C	T	10: 100,087,364	P208S	probably benign	Het
Lpcat4	A	G	2: 112,246,748	Y479C	probably damaging	Het
Lrrc74b	T	C	16: 17,553,152	N227S	probably damaging	Het
Mdc1	T	A	17: 35,852,581	V1007D	probably damaging	Het
Mocos	T	G	18: 24,679,762	I571S	probably benign	Het
Myh8	A	G	11: 67,292,188	N659D	probably damaging	Het
Naip2	A	G	13: 100,183,788	V240A	probably benign	Het
Nap1l1	T	C	10: 111,485,509	S37P	probably benign	Het
Nin	T	G	12: 70,051,141	K515T	probably damaging	Het
Npl	T	A	1: 153,509,118	K258*	probably null	Het
Ntn4	T	A	10: 93,644,707	S98T	possibly damaging	Het
Olfr177	C	A	16: 58,872,906	M81I	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr417	T	C	1: 174,369,586	V223A	probably damaging	Het
Ppox	C	A	1: 171,279,275	A192S	possibly damaging	Het
Prkdc	T	C	16: 15,713,653	L1380S	probably benign	Het
Psd4	C	A	2: 24,405,351	A839E	probably damaging	Het
Ptprn2	T	G	12: 116,722,091	F57V	probably damaging	Het
Ptprt	C	T	2: 162,278,110	V146I	probably benign	Het
R3hdm2	T	A	10: 127,498,453	M915K	probably damaging	Het
Rab26	C	T	17: 24,530,785		probably null	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Rprd2	T	C	3: 95,774,361	K407E	probably damaging	Het
Siah3	G	A	14: 75,456,134	V27I	possibly damaging	Het
Slc14a2	T	A	18: 78,192,123	N280Y	probably damaging	Het
Slc25a35	A	G	11: 68,971,960	Y247C	probably damaging	Het
Slc29a4	A	G	5: 142,705,530	D55G	probably benign	Het
Slc35d1	C	T	4: 103,208,181	V189I	probably benign	Het
Srrm1	G	A	4: 135,340,573	R322*	probably null	Het
Stac3	A	T	10: 127,503,650	R138S	probably damaging	Het
Tmem260	T	A	14: 48,483,322	C306*	probably null	Het
Tspyl1	A	G	10: 34,283,089	N270S	probably damaging	Het
Ugt2a2	T	A	5: 87,474,861	K293*	probably null	Het
Vmn2r102	A	C	17: 19,678,763	T456P	probably benign	Het
Vmn2r90	T	A	17: 17,712,249	S139R	probably benign	Het
Zmym2	A	G	14: 56,943,258	N876D	probably benign	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52213006	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52204447	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52210580	frame shift	probably null
R8909:Chd8	UTSW	14	52212932	missense	possibly damaging	0.82
R9194:Chd8	UTSW	14	52202193	missense	probably benign	0.01
R9278:Chd8	UTSW	14	52235170	missense	probably benign	0.01
R9489:Chd8	UTSW	14	52219598	missense	probably damaging	0.98
R9501:Chd8	UTSW	14	52214588	missense	probably benign	0.04
R9546:Chd8	UTSW	14	52215951	missense	probably damaging	1.00
R9605:Chd8	UTSW	14	52219598	missense	probably damaging	0.98
R9694:Chd8	UTSW	14	52203884	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AGAGTCTGAATCATCCTCGTCCTCC -3'
(R):5'- GTTGCAGAACCTCCAGACCCTAATC -3'

Sequencing Primer
(F):5'- TGTATCTGAAGAGCCTACGC -3'
(R):5'- AGACCCTAATCTGTTCATTGAGCC -3'

Posted On

2013-04-11