Incidental Mutation 'R1964:Mapk9'
ID217131
Institutional Source Beutler Lab
Gene Symbol Mapk9
Ensembl Gene ENSMUSG00000020366
Gene Namemitogen-activated protein kinase 9
SynonymsJNK2, JNK/SAPK alpha, Prkm9
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49846751-49886421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49854333 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 25 (R25S)
Ref Sequence ENSEMBL: ENSMUSP00000104807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020634] [ENSMUST00000043321] [ENSMUST00000102778] [ENSMUST00000109178] [ENSMUST00000109179] [ENSMUST00000164643] [ENSMUST00000178543]
Predicted Effect probably damaging
Transcript: ENSMUST00000020634
AA Change: R25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020634
Gene: ENSMUSG00000020366
AA Change: R25S

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000043321
AA Change: R25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042744
Gene: ENSMUSG00000020366
AA Change: R25S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102778
AA Change: R25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099839
Gene: ENSMUSG00000020366
AA Change: R25S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109178
AA Change: R25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104807
Gene: ENSMUSG00000020366
AA Change: R25S

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109179
AA Change: R25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104808
Gene: ENSMUSG00000020366
AA Change: R25S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151695
Predicted Effect probably damaging
Transcript: ENSMUST00000164643
AA Change: R25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132864
Gene: ENSMUSG00000020366
AA Change: R25S

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178543
AA Change: R25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136977
Gene: ENSMUSG00000020366
AA Change: R25S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a null allele show resistance to TNF-induced liver injury, impaired TH1 cell differentiation, and enhanced epidermal differentiation and proliferation. Homozygotes for a reporter allele show impaired T-cell activation and apoptosis, resistance to I-R cardiac injury, and reduced LTP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Abca6 T A 11: 110,184,676 I1330F probably damaging Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Cul4a G A 8: 13,136,406 M505I possibly damaging Het
Cul4a T C 8: 13,136,854 M530T probably benign Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itga5 A G 15: 103,354,314 L309P probably damaging Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rgl1 T A 1: 152,549,104 I375F probably damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Smgc G A 15: 91,860,270 G239D probably damaging Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tln2 T C 9: 67,342,135 D890G probably benign Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vcan A G 13: 89,692,742 V1561A probably benign Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Mapk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Mapk9 APN 11 49867038 missense probably damaging 1.00
IGL03399:Mapk9 APN 11 49883299 utr 3 prime probably benign
Infirm UTSW 11 49863556 missense probably damaging 1.00
R0003:Mapk9 UTSW 11 49867039 missense possibly damaging 0.52
R0610:Mapk9 UTSW 11 49863573 missense probably benign 0.00
R0676:Mapk9 UTSW 11 49883156 makesense probably null
R0681:Mapk9 UTSW 11 49869245 missense probably damaging 1.00
R0736:Mapk9 UTSW 11 49883254 missense possibly damaging 0.58
R1186:Mapk9 UTSW 11 49878269 missense probably damaging 0.99
R2424:Mapk9 UTSW 11 49863672 missense probably damaging 1.00
R4876:Mapk9 UTSW 11 49854325 missense probably damaging 0.97
R6191:Mapk9 UTSW 11 49863556 missense probably damaging 1.00
R7059:Mapk9 UTSW 11 49867047 splice site probably null
R7484:Mapk9 UTSW 11 49872836 missense probably damaging 0.97
R7951:Mapk9 UTSW 11 49863595 missense probably damaging 1.00
RF010:Mapk9 UTSW 11 49854256 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGAAGTCCCAGCAGATCAG -3'
(R):5'- ACAGCAAGGACTGATTTAGTTTAGC -3'

Sequencing Primer
(F):5'- GCAGATCAGAACCACTGTGTATAC -3'
(R):5'- CTAAAGGCTTCGTCTGTG -3'
Posted On2014-08-01