Incidental Mutation 'R1964:Abca6'
ID217136
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110184676 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1330 (I1330F)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: I1330F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: I1330F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Cul4a G A 8: 13,136,406 M505I possibly damaging Het
Cul4a T C 8: 13,136,854 M530T probably benign Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itga5 A G 15: 103,354,314 L309P probably damaging Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mapk9 C A 11: 49,854,333 R25S probably null Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rgl1 T A 1: 152,549,104 I375F probably damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Smgc G A 15: 91,860,270 G239D probably damaging Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tln2 T C 9: 67,342,135 D890G probably benign Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vcan A G 13: 89,692,742 V1561A probably benign Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTAACATGCCAATTCCTGTC -3'
(R):5'- AAGAATATTTTCAGGGTGTATGCCG -3'

Sequencing Primer
(F):5'- GTAACATGCCAATTCCTGTCATAAAC -3'
(R):5'- TCATTTCCAACACTGATAGTC -3'
Posted On2014-08-01