Mutagenetix > Incidental Mutation

Incidental Mutation 'R1964:Dnah11'

217141

Institutional Source

Beutler Lab

Gene Symbol

Dnah11

Ensembl Gene

ENSMUSG00000018581

Gene Name

dynein, axonemal, heavy chain 11

Synonyms

b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo

MMRRC Submission

039977-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R1964 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117877982-118199043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118142292 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 625 (E625G)

Ref Sequence

ENSEMBL: ENSMUSP00000081867 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084806]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084806
AA Change: E625G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: E625G

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
Pfam:DHC_N1	218	794	1.6e-162	PFAM
low complexity region	1266	1282	N/A	INTRINSIC
Pfam:DHC_N2	1297	1705	1e-130	PFAM
low complexity region	1757	1773	N/A	INTRINSIC
AAA	1869	1963	1.51e0	SMART
Pfam:AAA_5	2150	2286	1.6e-12	PFAM
AAA	2474	2619	1.48e-1	SMART
AAA	2819	2931	4.57e-1	SMART
Pfam:MT	3069	3413	3.2e-162	PFAM
Pfam:AAA_9	3434	3656	2.9e-88	PFAM
Pfam:Dynein_heavy	3790	4486	7.1e-235	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	C	T	17: 8,992,492	H158Y	probably damaging	Het
1810009J06Rik	T	A	6: 40,968,207	C207S	probably damaging	Het
Aadac	T	A	3: 60,037,338		probably null	Het
Abca6	T	A	11: 110,184,676	I1330F	probably damaging	Het
Adar	A	T	3: 89,745,895	S263C	probably benign	Het
Adra2b	T	C	2: 127,363,814	Y84H	probably damaging	Het
Arnt2	A	T	7: 84,343,789	V181E	possibly damaging	Het
Atg7	T	C	6: 114,706,230	L418P	probably damaging	Het
Atp2c1	A	G	9: 105,446,123	L181P	probably damaging	Het
Awat2	G	A	X: 100,404,559	P148S	probably damaging	Het
Birc6	A	G	17: 74,634,885	M2737V	possibly damaging	Het
Ccdc81	A	G	7: 89,886,153	C292R	probably benign	Het
Cd14	T	A	18: 36,726,339	E21V	probably damaging	Het
Cdc14b	A	C	13: 64,215,537	C303W	probably damaging	Het
Cdh23	T	C	10: 60,385,222	I1248V	probably benign	Het
Ceacam1	T	C	7: 25,474,708	D174G	probably benign	Het
Chd7	A	G	4: 8,865,978	M717V	probably damaging	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Clec4d	A	G	6: 123,262,360	K9R	probably benign	Het
Cntnap1	C	A	11: 101,178,024	S131*	probably null	Het
Crybg1	T	C	10: 43,958,330	K1581R	probably damaging	Het
Csf2	T	G	11: 54,248,458	T100P	probably benign	Het
Csrp2	T	A	10: 110,932,033	D26E	probably benign	Het
Cul1	T	C	6: 47,502,571	V257A	probably damaging	Het
Cul4a	G	A	8: 13,136,406	M505I	possibly damaging	Het
Cul4a	T	C	8: 13,136,854	M530T	probably benign	Het
Dcp2	T	C	18: 44,395,971	M51T	possibly damaging	Het
Ddx60	T	A	8: 61,948,869	C260S	probably benign	Het
Dennd2c	G	A	3: 103,166,491	R851H	probably damaging	Het
Edem1	T	C	6: 108,844,947	W322R	probably benign	Het
Egflam	T	C	15: 7,247,105	T527A	probably damaging	Het
Ephb1	T	A	9: 101,971,123	M659L	possibly damaging	Het
Fbxl2	A	G	9: 113,989,169	I203T	probably benign	Het
Gabbr1	G	A	17: 37,048,459	G109R	probably damaging	Het
Gabra2	T	C	5: 71,014,450	I148V	possibly damaging	Het
Golga1	A	G	2: 39,047,087	V161A	probably benign	Het
Gps2	T	G	11: 69,916,420	S301A	probably benign	Het
H2-D1	T	C	17: 35,263,619	L105P	probably benign	Het
Igdcc4	T	C	9: 65,122,769	V367A	probably benign	Het
Igkv4-69	T	G	6: 69,283,798	Y115S	probably benign	Het
Itga5	A	G	15: 103,354,314	L309P	probably damaging	Het
Itih1	A	G	14: 30,929,623	Y871H	probably damaging	Het
Itpr2	T	A	6: 146,111,693	N2662I	probably damaging	Het
Kctd19	T	A	8: 105,388,470	E486D	probably damaging	Het
Kif5b	C	T	18: 6,209,059	R901Q	possibly damaging	Het
Kmt2a	G	A	9: 44,820,644	S2792F	probably benign	Het
Magi3	A	G	3: 104,020,402	V1023A	probably damaging	Het
Mapk9	C	A	11: 49,854,333	R25S	probably null	Het
Mb21d1	T	G	9: 78,437,455	Y228S	probably damaging	Het
Memo1	T	C	17: 74,245,008	T98A	possibly damaging	Het
Mill2	A	G	7: 18,856,604	K203R	probably damaging	Het
Mios	T	A	6: 8,215,798	H331Q	probably damaging	Het
Muc6	G	T	7: 141,640,062	S1566*	probably null	Het
Muc6	A	G	7: 141,640,063		probably benign	Het
Napsa	T	C	7: 44,581,685	F113L	probably benign	Het
Olfr1154	A	G	2: 87,903,667	V3A	probably benign	Het
Olfr198	T	A	16: 59,201,908	I173F	possibly damaging	Het
Oscp1	T	G	4: 126,083,622	V226G	possibly damaging	Het
Osgin2	G	T	4: 15,998,358	S421R	probably damaging	Het
Pclaf	A	G	9: 65,893,395	N50D	probably damaging	Het
Pdgfc	A	T	3: 81,174,985	I162F	probably benign	Het
Plag1	T	C	4: 3,903,956	T412A	probably benign	Het
Pogz	A	T	3: 94,878,193	T820S	probably benign	Het
Ptpn9	T	A	9: 57,059,912	V473D	probably damaging	Het
Qdpr	A	T	5: 45,439,318	M66K	possibly damaging	Het
Qrich1	A	G	9: 108,534,422	N382S	possibly damaging	Het
Rbbp8	T	C	18: 11,742,679	V883A	possibly damaging	Het
Rgl1	T	A	1: 152,549,104	I375F	probably damaging	Het
Rif1	C	T	2: 52,098,409	T720I	probably benign	Het
Rilp	A	T	11: 75,510,502	Q95L	probably benign	Het
Rnf169	T	A	7: 99,925,525	N621I	probably damaging	Het
Rps27a	T	C	11: 29,547,229	K27R	probably null	Het
Sar1a	T	C	10: 61,685,168	V54A	probably benign	Het
Sash1	T	A	10: 8,729,713	H971L	probably benign	Het
Sdk2	G	A	11: 113,781,017	Q2102*	probably null	Het
Serpina1e	T	A	12: 103,951,207	I68F	probably damaging	Het
Serpinb9e	A	C	13: 33,253,491	Q119P	probably benign	Het
Sh3tc2	A	T	18: 61,991,155	K965*	probably null	Het
Slc16a1	A	T	3: 104,649,466	S56C	probably damaging	Het
Slc26a11	T	A	11: 119,380,194	L563Q	possibly damaging	Het
Smarca2	G	T	19: 26,672,724	E24*	probably null	Het
Smgc	G	A	15: 91,860,270	G239D	probably damaging	Het
Sos2	A	T	12: 69,616,862	M616K	possibly damaging	Het
Tet1	T	A	10: 62,812,947	D1902V	possibly damaging	Het
Thap2	C	T	10: 115,384,247	C10Y	probably damaging	Het
Tln2	T	C	9: 67,342,135	D890G	probably benign	Het
Tor2a	G	A	2: 32,758,704	G62D	probably damaging	Het
Ubqln5	A	T	7: 104,128,888	V243E	possibly damaging	Het
Utrn	A	T	10: 12,684,437	D1369E	probably damaging	Het
Vcan	A	G	13: 89,692,742	V1561A	probably benign	Het
Vmn1r70	T	C	7: 10,633,810	F56S	possibly damaging	Het
Vmn2r25	A	G	6: 123,823,295	L696S	possibly damaging	Het
Washc2	A	G	6: 116,208,987	T53A	probably damaging	Het
Wnk1	T	A	6: 119,934,382	T2417S	possibly damaging	Het
Zbtb49	A	T	5: 38,203,761	C12*	probably null	Het
Zfp472	C	A	17: 32,977,874	P308T	possibly damaging	Het

Other mutations in Dnah11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Dnah11	APN	12	118198745	missense	probably benign	0.28
IGL00422:Dnah11	APN	12	118068096	missense	probably damaging	1.00
IGL00436:Dnah11	APN	12	118036459	missense	possibly damaging	0.56
IGL00540:Dnah11	APN	12	118186922	missense	probably benign	0.01
IGL00687:Dnah11	APN	12	117922004	splice site	probably benign
IGL00833:Dnah11	APN	12	118179580	missense	probably damaging	1.00
IGL00906:Dnah11	APN	12	117911202	missense	probably damaging	1.00
IGL00952:Dnah11	APN	12	118196651	missense	possibly damaging	0.56
IGL01111:Dnah11	APN	12	118142934	splice site	probably benign
IGL01121:Dnah11	APN	12	118050695	missense	probably benign	0.02
IGL01143:Dnah11	APN	12	118012740	missense	probably damaging	1.00
IGL01359:Dnah11	APN	12	117982999	missense	probably damaging	0.99
IGL01372:Dnah11	APN	12	118192399	missense	probably damaging	1.00
IGL01410:Dnah11	APN	12	118047256	nonsense	probably null
IGL01418:Dnah11	APN	12	117987482	nonsense	probably null
IGL01444:Dnah11	APN	12	118020232	missense	possibly damaging	0.91
IGL01606:Dnah11	APN	12	117983032	missense	probably benign	0.15
IGL01645:Dnah11	APN	12	118186998	missense	possibly damaging	0.90
IGL01932:Dnah11	APN	12	118192270	splice site	probably benign
IGL02104:Dnah11	APN	12	118192390	missense	probably benign
IGL02151:Dnah11	APN	12	118059888	splice site	probably benign
IGL02189:Dnah11	APN	12	118082579	missense	probably benign	0.00
IGL02417:Dnah11	APN	12	118057180	missense	probably damaging	1.00
IGL02421:Dnah11	APN	12	118186902	missense	probably damaging	1.00
IGL02444:Dnah11	APN	12	117975873	splice site	probably benign
IGL02474:Dnah11	APN	12	118027445	splice site	probably null
IGL02526:Dnah11	APN	12	118179618	missense	possibly damaging	0.70
IGL02887:Dnah11	APN	12	117911040	missense	probably damaging	1.00
IGL03011:Dnah11	APN	12	118012377	missense	probably benign	0.08
IGL03061:Dnah11	APN	12	117903121	missense	probably damaging	1.00
IGL03182:Dnah11	APN	12	118030291	missense	probably damaging	0.99
IGL03220:Dnah11	APN	12	118105985	missense	probably benign
IGL03238:Dnah11	APN	12	118109898	missense	probably damaging	1.00
IGL03493:Dnah11	APN	12	118012798	missense	probably benign	0.00
P0045:Dnah11	UTSW	12	118030327	missense	probably benign
R0009:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R0066:Dnah11	UTSW	12	118126886	missense	probably benign	0.05
R0172:Dnah11	UTSW	12	117987453	missense	probably damaging	1.00
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0208:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0230:Dnah11	UTSW	12	117983056	nonsense	probably null
R0270:Dnah11	UTSW	12	118041013	missense	probably damaging	1.00
R0311:Dnah11	UTSW	12	118127133	missense	probably benign	0.03
R0325:Dnah11	UTSW	12	118012339	missense	probably benign
R0370:Dnah11	UTSW	12	117995227	missense	probably benign
R0416:Dnah11	UTSW	12	117911058	missense	probably damaging	1.00
R0505:Dnah11	UTSW	12	118106510	missense	probably damaging	1.00
R0540:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0554:Dnah11	UTSW	12	117931178	missense	probably benign	0.01
R0607:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0620:Dnah11	UTSW	12	117987469	missense	probably damaging	1.00
R0635:Dnah11	UTSW	12	118007996	missense	probably damaging	1.00
R0755:Dnah11	UTSW	12	117954829	missense	possibly damaging	0.95
R0755:Dnah11	UTSW	12	118198625	missense	probably benign	0.17
R0789:Dnah11	UTSW	12	117911232	missense	probably damaging	1.00
R0833:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0835:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R0836:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0846:Dnah11	UTSW	12	117933850	missense	probably damaging	0.97
R0865:Dnah11	UTSW	12	118190844	nonsense	probably null
R0928:Dnah11	UTSW	12	118045562	missense	probably damaging	1.00
R0939:Dnah11	UTSW	12	118060407	missense	probably damaging	1.00
R1203:Dnah11	UTSW	12	117933812	missense	possibly damaging	0.81
R1394:Dnah11	UTSW	12	117972364	missense	possibly damaging	0.75
R1398:Dnah11	UTSW	12	118057106	nonsense	probably null
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1500:Dnah11	UTSW	12	118012829	splice site	probably null
R1535:Dnah11	UTSW	12	118018730	missense	probably damaging	1.00
R1539:Dnah11	UTSW	12	117931256	missense	probably benign	0.01
R1554:Dnah11	UTSW	12	118082499	missense	possibly damaging	0.92
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1615:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R1618:Dnah11	UTSW	12	118015465	missense	probably damaging	0.98
R1638:Dnah11	UTSW	12	118015419	missense	possibly damaging	0.81
R1659:Dnah11	UTSW	12	118120724	missense	possibly damaging	0.94
R1671:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1678:Dnah11	UTSW	12	117933845	missense	possibly damaging	0.50
R1699:Dnah11	UTSW	12	118190868	missense	probably damaging	1.00
R1712:Dnah11	UTSW	12	118196644	missense	probably benign	0.32
R1728:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1729:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1764:Dnah11	UTSW	12	118190825	missense	probably benign	0.31
R1780:Dnah11	UTSW	12	118027558	missense	probably damaging	1.00
R1789:Dnah11	UTSW	12	118038780	missense	probably damaging	0.99
R1800:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1863:Dnah11	UTSW	12	118063852	missense	possibly damaging	0.92
R1892:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R1907:Dnah11	UTSW	12	118127556	missense	possibly damaging	0.66
R1967:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1997:Dnah11	UTSW	12	118082468	missense	possibly damaging	0.64
R2086:Dnah11	UTSW	12	118113871	missense	possibly damaging	0.82
R2092:Dnah11	UTSW	12	118012716	missense	possibly damaging	0.50
R2108:Dnah11	UTSW	12	118020353	missense	probably damaging	1.00
R2140:Dnah11	UTSW	12	118008810	missense	probably benign	0.01
R2261:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2261:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2262:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2262:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2263:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2263:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2328:Dnah11	UTSW	12	117886686	missense	probably damaging	0.98
R2352:Dnah11	UTSW	12	117928330	missense	probably damaging	1.00
R2410:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R2885:Dnah11	UTSW	12	117987427	nonsense	probably null
R3499:Dnah11	UTSW	12	117911023	missense	probably damaging	1.00
R3741:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3742:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3779:Dnah11	UTSW	12	118130713	splice site	probably benign
R3785:Dnah11	UTSW	12	118017602	missense	probably damaging	1.00
R3883:Dnah11	UTSW	12	117978453	splice site	probably benign
R4014:Dnah11	UTSW	12	117974914	missense	probably benign	0.16
R4043:Dnah11	UTSW	12	117879943	missense	probably damaging	1.00
R4072:Dnah11	UTSW	12	118106492	missense	probably damaging	1.00
R4073:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4074:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4076:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4201:Dnah11	UTSW	12	117966659	missense	possibly damaging	0.63
R4224:Dnah11	UTSW	12	118130892	missense	probably benign	0.06
R4233:Dnah11	UTSW	12	117916791	missense	probably damaging	1.00
R4358:Dnah11	UTSW	12	118125843	nonsense	probably null
R4430:Dnah11	UTSW	12	117983011	missense	probably benign	0.26
R4465:Dnah11	UTSW	12	117987451	missense	probably benign	0.09
R4489:Dnah11	UTSW	12	117916896	missense	probably benign	0.31
R4572:Dnah11	UTSW	12	118010125	missense	probably benign	0.00
R4574:Dnah11	UTSW	12	118012255	critical splice donor site	probably null
R4657:Dnah11	UTSW	12	118192427	missense	probably benign	0.02
R4709:Dnah11	UTSW	12	118018760	missense	probably benign	0.26
R4740:Dnah11	UTSW	12	118120544	missense	probably benign	0.28
R4803:Dnah11	UTSW	12	118127608	missense	possibly damaging	0.50
R4896:Dnah11	UTSW	12	117995200	missense	probably damaging	1.00
R4908:Dnah11	UTSW	12	118126883	missense	probably benign	0.37
R5018:Dnah11	UTSW	12	118130728	missense	probably benign	0.00
R5071:Dnah11	UTSW	12	118082453	nonsense	probably null
R5074:Dnah11	UTSW	12	118082453	nonsense	probably null
R5080:Dnah11	UTSW	12	118198830	start codon destroyed	probably null	0.01
R5097:Dnah11	UTSW	12	118017700	missense	probably damaging	1.00
R5131:Dnah11	UTSW	12	117954751	missense	probably damaging	1.00
R5215:Dnah11	UTSW	12	118157361	missense	probably benign	0.09
R5252:Dnah11	UTSW	12	118125941	missense	probably damaging	1.00
R5296:Dnah11	UTSW	12	117883416	missense	probably damaging	1.00
R5308:Dnah11	UTSW	12	118085680	missense	possibly damaging	0.60
R5368:Dnah11	UTSW	12	117954893	missense	probably damaging	1.00
R5383:Dnah11	UTSW	12	118085697	missense	probably damaging	0.99
R5499:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R5503:Dnah11	UTSW	12	117880451	critical splice donor site	probably null
R5546:Dnah11	UTSW	12	117975848	missense	possibly damaging	0.83
R5578:Dnah11	UTSW	12	118018802	missense	probably damaging	0.99
R5657:Dnah11	UTSW	12	117883617	missense	probably damaging	1.00
R5702:Dnah11	UTSW	12	118113907	missense	probably benign	0.04
R5706:Dnah11	UTSW	12	118023935	missense	probably damaging	1.00
R5727:Dnah11	UTSW	12	118127106	missense	probably damaging	1.00
R5737:Dnah11	UTSW	12	118192390	missense	probably benign
R5884:Dnah11	UTSW	12	118177534	missense	probably benign	0.00
R5900:Dnah11	UTSW	12	118082431	splice site	probably null
R5905:Dnah11	UTSW	12	117954924	missense	probably damaging	1.00
R5928:Dnah11	UTSW	12	117914636	splice site	probably null
R5973:Dnah11	UTSW	12	118110952	missense	probably benign	0.02
R6024:Dnah11	UTSW	12	118030272	missense	probably benign	0.34
R6056:Dnah11	UTSW	12	117928456	missense	probably benign	0.03
R6075:Dnah11	UTSW	12	118104851	missense	probably damaging	1.00
R6092:Dnah11	UTSW	12	117928456	missense	probably benign
R6191:Dnah11	UTSW	12	118190897	missense	probably benign
R6197:Dnah11	UTSW	12	118179747	missense	probably benign	0.03
R6262:Dnah11	UTSW	12	117931178	missense	probably damaging	0.98
R6321:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R6454:Dnah11	UTSW	12	117916855	missense	probably benign	0.01
R6614:Dnah11	UTSW	12	117886676	missense	possibly damaging	0.72
R6694:Dnah11	UTSW	12	118186882	splice site	probably null
R6712:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R6720:Dnah11	UTSW	12	118045646	missense	probably damaging	1.00
R6742:Dnah11	UTSW	12	118113894	missense	possibly damaging	0.82
R6806:Dnah11	UTSW	12	117987676	splice site	probably null
R6895:Dnah11	UTSW	12	117995191	missense	probably damaging	0.99
R6939:Dnah11	UTSW	12	118106562	missense	probably damaging	1.00
R6940:Dnah11	UTSW	12	118198768	missense	probably benign
R6945:Dnah11	UTSW	12	118060310	missense	probably damaging	1.00
R6958:Dnah11	UTSW	12	117933809	missense	probably damaging	1.00
R6970:Dnah11	UTSW	12	118108944	missense	probably benign	0.00
R6976:Dnah11	UTSW	12	118198643	missense	probably benign	0.16
R7000:Dnah11	UTSW	12	118017661	missense	probably damaging	1.00
R7011:Dnah11	UTSW	12	117922018	frame shift	probably null
R7101:Dnah11	UTSW	12	118068145	missense	probably benign
R7106:Dnah11	UTSW	12	117961149	missense	probably benign	0.15
R7203:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R7219:Dnah11	UTSW	12	118041095	missense	possibly damaging	0.95
R7219:Dnah11	UTSW	12	118126889	missense	probably benign	0.00
R7308:Dnah11	UTSW	12	117995275	missense	probably damaging	1.00
R7361:Dnah11	UTSW	12	118018742	missense	probably damaging	1.00
R7367:Dnah11	UTSW	12	117987442	missense	possibly damaging	0.59
R7399:Dnah11	UTSW	12	118027477	missense	probably benign	0.00
R7399:Dnah11	UTSW	12	118125785	missense	probably damaging	1.00
R7404:Dnah11	UTSW	12	118104808	missense	probably benign	0.36
R7473:Dnah11	UTSW	12	117903176	missense	probably benign	0.19
R7545:Dnah11	UTSW	12	117931204	missense	probably damaging	1.00
R7608:Dnah11	UTSW	12	118140770	splice site	probably null
R7625:Dnah11	UTSW	12	118196642	missense	probably benign
R7761:Dnah11	UTSW	12	118023913	missense	probably damaging	1.00
R7879:Dnah11	UTSW	12	118041009	missense	probably damaging	1.00
R7881:Dnah11	UTSW	12	117987502	missense	probably benign	0.04
R7904:Dnah11	UTSW	12	117903268	missense	possibly damaging	0.72
R8100:Dnah11	UTSW	12	117966633	missense	probably damaging	0.99
R8179:Dnah11	UTSW	12	117878549	missense	possibly damaging	0.90
R8192:Dnah11	UTSW	12	118012446	missense	probably benign
R8254:Dnah11	UTSW	12	117878524	missense	possibly damaging	0.89
R8268:Dnah11	UTSW	12	118027508	nonsense	probably null
R8272:Dnah11	UTSW	12	118111017	missense	probably benign	0.01
R8344:Dnah11	UTSW	12	118085731	missense	probably benign	0.00
R8515:Dnah11	UTSW	12	117975798	missense	probably damaging	1.00
R8528:Dnah11	UTSW	12	118008803	missense	probably damaging	0.96
R8557:Dnah11	UTSW	12	117878512	missense	probably benign
R8676:Dnah11	UTSW	12	118190804	missense	probably damaging	1.00
R8738:Dnah11	UTSW	12	118085649	critical splice donor site	probably null
R8773:Dnah11	UTSW	12	117995215	missense	possibly damaging	0.94
R8818:Dnah11	UTSW	12	117911029	missense	probably damaging	1.00
R8855:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8866:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8881:Dnah11	UTSW	12	118113912	missense	probably benign	0.00
R8881:Dnah11	UTSW	12	118126815	missense	probably benign	0.05
R8920:Dnah11	UTSW	12	118113939	missense	probably damaging	0.99
R8944:Dnah11	UTSW	12	118127646	missense	possibly damaging	0.63
R8945:Dnah11	UTSW	12	118023983	missense	probably benign	0.36
R8962:Dnah11	UTSW	12	117952538	missense	probably damaging	1.00
R8962:Dnah11	UTSW	12	117954895	missense	probably damaging	1.00
R9059:Dnah11	UTSW	12	118130843	missense	probably benign	0.00
R9155:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9162:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9164:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9171:Dnah11	UTSW	12	117931183	missense	probably damaging	0.99
R9186:Dnah11	UTSW	12	118190897	missense	probably benign
R9205:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9208:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9234:Dnah11	UTSW	12	117987360	missense	probably damaging	1.00
R9264:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R9290:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9291:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9315:Dnah11	UTSW	12	118179606	missense	probably benign	0.11
R9353:Dnah11	UTSW	12	118179699	missense	probably benign	0.00
R9375:Dnah11	UTSW	12	117920968	missense	possibly damaging	0.67
R9392:Dnah11	UTSW	12	118047320	nonsense	probably null
R9392:Dnah11	UTSW	12	118177555	missense	probably benign	0.00
R9433:Dnah11	UTSW	12	118012272	missense	probably damaging	1.00
R9511:Dnah11	UTSW	12	117914617	missense	probably damaging	1.00
R9526:Dnah11	UTSW	12	118186976	missense	probably damaging	0.98
R9566:Dnah11	UTSW	12	117974993	missense	possibly damaging	0.69
R9673:Dnah11	UTSW	12	118018778	missense	possibly damaging	0.91
R9705:Dnah11	UTSW	12	118131035	missense	probably damaging	1.00
R9716:Dnah11	UTSW	12	118060413	missense	probably damaging	0.99
R9746:Dnah11	UTSW	12	117878576	nonsense	probably null
R9764:Dnah11	UTSW	12	117920969	missense	probably benign	0.05
RF023:Dnah11	UTSW	12	117954850	missense	probably damaging	1.00
RF047:Dnah11	UTSW	12	118010083	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117895012	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117982969	missense	probably damaging	1.00
Z1176:Dnah11	UTSW	12	117931177	missense	possibly damaging	0.81
Z1176:Dnah11	UTSW	12	118127119	missense	probably benign	0.00
Z1176:Dnah11	UTSW	12	118130799	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTGACAGCCACTTCCTTGTG -3'
(R):5'- GGACCTTGGCACTTCATTAATG -3'

Sequencing Primer
(F):5'- GACAGCCACTTCCTTGTGTGAAAG -3'
(R):5'- CAGCTGCTTATAAGGTTGG -3'

Posted On

2014-08-01