Incidental Mutation 'R1964:Vcan'
ID217144
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89692742 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1561 (V1561A)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109546
AA Change: V1561A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: V1561A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
AA Change: V601A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: V601A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Abca6 T A 11: 110,184,676 I1330F probably damaging Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Cul4a G A 8: 13,136,406 M505I possibly damaging Het
Cul4a T C 8: 13,136,854 M530T probably benign Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itga5 A G 15: 103,354,314 L309P probably damaging Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mapk9 C A 11: 49,854,333 R25S probably null Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rgl1 T A 1: 152,549,104 I375F probably damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Smgc G A 15: 91,860,270 G239D probably damaging Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tln2 T C 9: 67,342,135 D890G probably benign Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7171:Vcan UTSW 13 89725591 missense probably damaging 1.00
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
R7514:Vcan UTSW 13 89704118 missense probably damaging 0.97
R7579:Vcan UTSW 13 89692458 missense probably damaging 1.00
R7618:Vcan UTSW 13 89692223 missense probably damaging 0.99
R7655:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7656:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7676:Vcan UTSW 13 89691789 missense probably damaging 1.00
R7719:Vcan UTSW 13 89704619 missense probably damaging 0.98
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAAAGGGCTGAGTGTATCTG -3'
(R):5'- ACAACCTAAGCCTGTCCCTCTG -3'

Sequencing Primer
(F):5'- AGGATCTCTCTGTGGTAAATCAG -3'
(R):5'- GTCCCTCTGTTTCCTGAAGAG -3'
Posted On2014-08-01