Incidental Mutation 'R1964:Smgc'
ID217147
Institutional Source Beutler Lab
Gene Symbol Smgc
Ensembl Gene ENSMUSG00000047295
Gene Namesubmandibular gland protein C
SynonymsSfc21, DXImx49e, 2310010P21Rik
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location91838265-91861438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91860270 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 239 (G239D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088555] [ENSMUST00000100293] [ENSMUST00000109276] [ENSMUST00000109277] [ENSMUST00000130014]
Predicted Effect probably damaging
Transcript: ENSMUST00000088555
AA Change: G623D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085915
Gene: ENSMUSG00000047295
AA Change: G623D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_1 55 224 2.76e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 2.76e-22 PROSPERO
low complexity region 563 574 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 652 667 N/A INTRINSIC
low complexity region 677 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100293
AA Change: G590D

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097866
Gene: ENSMUSG00000047295
AA Change: G590D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_2 32 180 5.58e-9 PROSPERO
internal_repeat_1 55 224 1.24e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 1.24e-22 PROSPERO
internal_repeat_2 420 569 5.58e-9 PROSPERO
low complexity region 576 593 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 644 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109276
AA Change: G47D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104899
Gene: ENSMUSG00000047295
AA Change: G47D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109277
AA Change: G18D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104900
Gene: ENSMUSG00000047295
AA Change: G18D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
low complexity region 72 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130014
AA Change: G275D

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118530
Gene: ENSMUSG00000047295
AA Change: G275D

DomainStartEndE-ValueType
internal_repeat_1 113 156 5.82e-16 PROSPERO
low complexity region 179 189 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
internal_repeat_1 233 276 5.82e-16 PROSPERO
low complexity region 304 319 N/A INTRINSIC
low complexity region 329 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132674
AA Change: G239D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120578
Gene: ENSMUSG00000047295
AA Change: G239D

DomainStartEndE-ValueType
internal_repeat_1 12 37 9.28e-9 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 194 219 9.28e-9 PROSPERO
low complexity region 226 243 N/A INTRINSIC
low complexity region 269 284 N/A INTRINSIC
low complexity region 294 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136172
AA Change: G214D

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119575
Gene: ENSMUSG00000047295
AA Change: G214D

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 201 218 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Abca6 T A 11: 110,184,676 I1330F probably damaging Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Cul4a G A 8: 13,136,406 M505I possibly damaging Het
Cul4a T C 8: 13,136,854 M530T probably benign Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itga5 A G 15: 103,354,314 L309P probably damaging Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mapk9 C A 11: 49,854,333 R25S probably null Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rgl1 T A 1: 152,549,104 I375F probably damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tln2 T C 9: 67,342,135 D890G probably benign Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vcan A G 13: 89,692,742 V1561A probably benign Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Smgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Smgc APN 15 91854543 splice site probably benign
IGL00835:Smgc APN 15 91844420 missense probably damaging 0.99
IGL01651:Smgc APN 15 91859788 intron probably benign
IGL01669:Smgc APN 15 91860684 missense possibly damaging 0.89
IGL01743:Smgc APN 15 91854593 missense probably benign 0.19
IGL01898:Smgc APN 15 91844524 splice site probably null
IGL03152:Smgc APN 15 91841422 missense possibly damaging 0.66
IGL03172:Smgc APN 15 91860444 missense probably damaging 0.99
IGL03352:Smgc APN 15 91860678 missense probably damaging 0.96
IGL03385:Smgc APN 15 91841978 missense possibly damaging 0.66
K7371:Smgc UTSW 15 91860255 splice site probably benign
R0090:Smgc UTSW 15 91859762 missense possibly damaging 0.91
R0125:Smgc UTSW 15 91854543 splice site probably benign
R0386:Smgc UTSW 15 91854638 missense probably benign 0.07
R0684:Smgc UTSW 15 91841467 unclassified probably benign
R1187:Smgc UTSW 15 91860600 missense probably damaging 0.99
R1586:Smgc UTSW 15 91838393 missense possibly damaging 0.90
R1848:Smgc UTSW 15 91859758 missense possibly damaging 0.58
R2144:Smgc UTSW 15 91844421 missense possibly damaging 0.81
R3499:Smgc UTSW 15 91842003 missense possibly damaging 0.66
R3842:Smgc UTSW 15 91860262 splice site probably benign
R3978:Smgc UTSW 15 91860348 missense probably damaging 0.99
R4173:Smgc UTSW 15 91860561 missense possibly damaging 0.95
R4692:Smgc UTSW 15 91854561 missense possibly damaging 0.46
R4761:Smgc UTSW 15 91845514 missense possibly damaging 0.66
R4794:Smgc UTSW 15 91841454 missense probably benign 0.27
R4801:Smgc UTSW 15 91854616 missense probably benign 0.01
R4802:Smgc UTSW 15 91854616 missense probably benign 0.01
R5621:Smgc UTSW 15 91844420 missense probably damaging 0.99
R5672:Smgc UTSW 15 91841905 missense possibly damaging 0.46
R5707:Smgc UTSW 15 91860663 missense possibly damaging 0.66
R5722:Smgc UTSW 15 91841906 missense possibly damaging 0.83
R6212:Smgc UTSW 15 91850627 intron probably benign
R6767:Smgc UTSW 15 91841398 missense possibly damaging 0.46
R7049:Smgc UTSW 15 91860378 missense possibly damaging 0.82
R7155:Smgc UTSW 15 91852608 missense possibly damaging 0.66
R7210:Smgc UTSW 15 91860294 missense probably damaging 0.99
R7448:Smgc UTSW 15 91845493 missense probably benign 0.02
R7474:Smgc UTSW 15 91860694 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGAGCTCTCTTGTTCCTGATTATG -3'
(R):5'- CATTTTAGGAATGGAATGCAGGTC -3'

Sequencing Primer
(F):5'- TTCCTGATTATGGTGGTGTAGAC -3'
(R):5'- GGTCAAGATACCTGAGTCACTCTTAC -3'
Posted On2014-08-01