Incidental Mutation 'R1964:Itga5'
ID217148
Institutional Source Beutler Lab
Gene Symbol Itga5
Ensembl Gene ENSMUSG00000000555
Gene Nameintegrin alpha 5 (fibronectin receptor alpha)
SynonymsFnra, Cd49e
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103344286-103366763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103354314 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 309 (L309P)
Ref Sequence ENSEMBL: ENSMUSP00000023128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]
Predicted Effect probably damaging
Transcript: ENSMUST00000023128
AA Change: L309P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: L309P

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
Int_alpha 59 118 2.27e-8 SMART
Int_alpha 271 321 9.6e-7 SMART
Int_alpha 325 387 1.03e-15 SMART
Int_alpha 391 447 4.17e-16 SMART
Int_alpha 455 511 1.49e-3 SMART
SCOP:d1m1xa2 651 789 3e-44 SMART
SCOP:d1m1xa3 792 992 1e-62 SMART
transmembrane domain 1003 1025 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183535
Predicted Effect probably benign
Transcript: ENSMUST00000215331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230775
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Abca6 T A 11: 110,184,676 I1330F probably damaging Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Cul4a G A 8: 13,136,406 M505I possibly damaging Het
Cul4a T C 8: 13,136,854 M530T probably benign Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mapk9 C A 11: 49,854,333 R25S probably null Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rgl1 T A 1: 152,549,104 I375F probably damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Smgc G A 15: 91,860,270 G239D probably damaging Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tln2 T C 9: 67,342,135 D890G probably benign Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vcan A G 13: 89,692,742 V1561A probably benign Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Itga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Itga5 APN 15 103350372 critical splice donor site probably null
IGL01102:Itga5 APN 15 103346675 missense probably benign 0.13
IGL01474:Itga5 APN 15 103354270 nonsense probably null
IGL01768:Itga5 APN 15 103351570 missense probably benign 0.34
IGL01832:Itga5 APN 15 103355949 nonsense probably null
IGL02188:Itga5 APN 15 103347717 missense probably benign 0.30
IGL02701:Itga5 APN 15 103347766 missense probably damaging 0.98
IGL02838:Itga5 APN 15 103351609 missense probably damaging 1.00
IGL02955:Itga5 APN 15 103350834 missense possibly damaging 0.48
R0617:Itga5 UTSW 15 103356315 critical splice donor site probably null
R0845:Itga5 UTSW 15 103350769 missense probably benign 0.07
R1210:Itga5 UTSW 15 103357473 missense possibly damaging 0.76
R1522:Itga5 UTSW 15 103356782 nonsense probably null
R1576:Itga5 UTSW 15 103351617 missense probably damaging 0.96
R1666:Itga5 UTSW 15 103347902 missense probably benign 0.00
R1808:Itga5 UTSW 15 103350399 missense probably damaging 1.00
R1836:Itga5 UTSW 15 103346014 missense probably damaging 1.00
R4290:Itga5 UTSW 15 103352257 critical splice donor site probably null
R4458:Itga5 UTSW 15 103350203 missense probably damaging 1.00
R4610:Itga5 UTSW 15 103350832 missense probably damaging 1.00
R4676:Itga5 UTSW 15 103357210 missense probably damaging 1.00
R4795:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4796:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4837:Itga5 UTSW 15 103354084 missense probably damaging 0.99
R4929:Itga5 UTSW 15 103353235 missense probably benign 0.42
R5896:Itga5 UTSW 15 103351087 missense probably benign
R5947:Itga5 UTSW 15 103356785 missense probably damaging 1.00
R5957:Itga5 UTSW 15 103351429 missense probably benign 0.05
R6153:Itga5 UTSW 15 103357453 missense probably damaging 1.00
R6353:Itga5 UTSW 15 103352523 missense probably damaging 0.98
R6657:Itga5 UTSW 15 103350795 missense probably damaging 1.00
R6698:Itga5 UTSW 15 103351381 missense probably benign 0.15
R6891:Itga5 UTSW 15 103357543 missense probably damaging 1.00
R6981:Itga5 UTSW 15 103350226 missense probably benign 0.00
R7574:Itga5 UTSW 15 103350449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGAACAAGGCTGGTCAG -3'
(R):5'- TGGCTGGGGATGAAAATCCATC -3'

Sequencing Primer
(F):5'- GGCTGGTCAGTAAACAGGATC -3'
(R):5'- CTGGGGATGAAAATCCATCAAGGG -3'
Posted On2014-08-01