Mutagenetix > Incidental Mutation

Incidental Mutation 'R1950:Trip12'

217169

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84760801 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 778 (W778R)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: W778R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: W778R

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185567

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: W778R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: W778R

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: W772R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: W772R

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186894
AA Change: W778R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: W778R

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	A	G	5: 3,960,677	N478S	probably damaging	Het
Als2	T	A	1: 59,185,601		probably null	Het
Ankfy1	A	G	11: 72,760,329	Y1035C	probably damaging	Het
Ankrd11	T	C	8: 122,889,869	T2394A	probably damaging	Het
Axin1	G	C	17: 26,193,964	G780R	possibly damaging	Het
Carm1	A	T	9: 21,574,516	T127S	probably benign	Het
Ccdc73	T	C	2: 104,926,935	I81T	probably benign	Het
Cdh12	T	C	15: 21,237,879	Y67H	probably damaging	Het
Cfap65	C	A	1: 74,907,660	G1297V	probably damaging	Het
Cfap74	T	C	4: 155,427,430		probably null	Het
Chit1	A	G	1: 134,151,230	Y426C	probably damaging	Het
Clpp	A	G	17: 56,996,039		probably benign	Het
Clrn3	T	G	7: 135,514,084	Y179S	possibly damaging	Het
Cntn5	A	C	9: 9,781,769	M635R	probably damaging	Het
Col12a1	A	T	9: 79,630,549	S2546T	possibly damaging	Het
Ctla2b	T	C	13: 60,896,049	N102S	possibly damaging	Het
Cwf19l2	A	T	9: 3,418,674	I154F	probably benign	Het
Cyhr1	A	G	15: 76,659,217		probably null	Het
Dffa	C	A	4: 149,104,382	S44R	probably benign	Het
Ehbp1	T	A	11: 22,059,228	K930M	probably damaging	Het
Erc2	T	A	14: 27,912,900	S473T	probably damaging	Het
Fam71f1	C	T	6: 29,335,816		probably null	Het
Fbxw24	A	T	9: 109,605,413	L373H	probably benign	Het
Fer1l4	T	C	2: 156,048,274	I244V	probably damaging	Het
Fgfr2	G	A	7: 130,198,481	T245M	probably damaging	Het
Gbp9	T	A	5: 105,081,246	M512L	probably benign	Het
Glg1	T	A	8: 111,165,639	K251I	possibly damaging	Het
Gm10553	A	G	1: 85,100,420	D86G	possibly damaging	Het
Gm10767	A	G	13: 66,907,205		probably benign	Het
Gm5622	T	C	14: 51,655,772	V52A	probably benign	Het
Gucy1b1	A	G	3: 82,045,409	V239A	probably benign	Het
Gzma	A	G	13: 113,093,929	L246P	probably damaging	Het
Hibadh	C	A	6: 52,556,463	A223S	probably benign	Het
Hydin	C	A	8: 110,609,987	T5132N	possibly damaging	Het
Insrr	A	G	3: 87,814,513	N1198S	probably damaging	Het
Ivl	T	C	3: 92,572,113	E215G	possibly damaging	Het
Jmjd1c	A	G	10: 67,239,922	D2037G	possibly damaging	Het
Kcna3	G	A	3: 107,037,672	C417Y	probably damaging	Het
Klra2	T	C	6: 131,230,115	N177S	probably benign	Het
Llgl2	T	C	11: 115,851,066	S645P	probably damaging	Het
Lrrc15	T	C	16: 30,273,831	E230G	probably benign	Het
Magel2	C	A	7: 62,378,415	Q356K	possibly damaging	Het
Mcm6	A	G	1: 128,345,989	V368A	probably benign	Het
Myh8	G	A	11: 67,279,004	V50M	possibly damaging	Het
Myrf	A	T	19: 10,218,190	F419I	possibly damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Olfr1330	G	A	4: 118,893,340	V86M	probably benign	Het
Olfr556	A	G	7: 102,670,477	M186V	probably benign	Het
Otud4	G	A	8: 79,646,332	R93H	probably damaging	Het
Pank4	T	A	4: 154,972,520	M390K	probably benign	Het
Pecam1	A	G	11: 106,685,203	V401A	probably damaging	Het
Prdm6	C	A	18: 53,536,724	T138K	possibly damaging	Het
Prl2c2	G	C	13: 13,002,201	T47R	probably damaging	Het
Prpf8	A	G	11: 75,496,511	E1206G	possibly damaging	Het
Prr30	A	T	14: 101,197,941	I395N	probably benign	Het
Rab27a	G	A	9: 73,075,469	G19R	probably damaging	Het
Rrp12	A	G	19: 41,892,590	V134A	probably damaging	Het
Scly	A	G	1: 91,305,394	T76A	probably benign	Het
Scube3	T	C	17: 28,164,300	S439P	possibly damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Sipa1l1	T	C	12: 82,341,459	F153S	probably damaging	Het
Slc25a30	T	G	14: 75,769,567	K163T	possibly damaging	Het
Slc26a8	T	A	17: 28,644,640	D715V	probably benign	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Smr2	C	CT	5: 88,108,826		probably null	Het
Sp6	T	G	11: 97,022,114	S218A	probably benign	Het
Spata21	T	C	4: 141,111,405	V589A	probably damaging	Het
Sycp2	T	C	2: 178,402,800	I71V	probably benign	Het
Syne2	G	T	12: 75,952,870	G2347C	probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Thbs4	A	T	13: 92,769,571	N387K	probably damaging	Het
Tmem184a	T	C	5: 139,807,626	D216G	probably damaging	Het
Tprg	T	A	16: 25,317,348	S30T	possibly damaging	Het
Ttpa	T	C	4: 20,008,633	L65P	probably damaging	Het
Ush2a	A	T	1: 188,755,185	N3050I	probably damaging	Het
Xpot	T	C	10: 121,619,148	I30V	probably benign	Het
Zfp944	A	G	17: 22,339,700	S189P	probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGACCTTCTTTCTCAGGAG -3'
(R):5'- CGAAGTCCTCAAGAGCTGTATGAG -3'

Sequencing Primer
(F):5'- GACCTTCTTTCTCAGGAGACAAAATG -3'
(R):5'- GCTGTATGAGCTGACATCTTTG -3'

Posted On

2014-08-01