Incidental Mutation 'R1950:Fer1l4'
ID217177
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1950 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156048274 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 244 (I244V)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
Predicted Effect probably damaging
Transcript: ENSMUST00000109611
AA Change: I244V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: I244V

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 3,960,677 N478S probably damaging Het
Als2 T A 1: 59,185,601 probably null Het
Ankfy1 A G 11: 72,760,329 Y1035C probably damaging Het
Ankrd11 T C 8: 122,889,869 T2394A probably damaging Het
Axin1 G C 17: 26,193,964 G780R possibly damaging Het
Carm1 A T 9: 21,574,516 T127S probably benign Het
Ccdc73 T C 2: 104,926,935 I81T probably benign Het
Cdh12 T C 15: 21,237,879 Y67H probably damaging Het
Cfap65 C A 1: 74,907,660 G1297V probably damaging Het
Cfap74 T C 4: 155,427,430 probably null Het
Chit1 A G 1: 134,151,230 Y426C probably damaging Het
Clpp A G 17: 56,996,039 probably benign Het
Clrn3 T G 7: 135,514,084 Y179S possibly damaging Het
Cntn5 A C 9: 9,781,769 M635R probably damaging Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Ctla2b T C 13: 60,896,049 N102S possibly damaging Het
Cwf19l2 A T 9: 3,418,674 I154F probably benign Het
Cyhr1 A G 15: 76,659,217 probably null Het
Dffa C A 4: 149,104,382 S44R probably benign Het
Ehbp1 T A 11: 22,059,228 K930M probably damaging Het
Erc2 T A 14: 27,912,900 S473T probably damaging Het
Fam71f1 C T 6: 29,335,816 probably null Het
Fbxw24 A T 9: 109,605,413 L373H probably benign Het
Fgfr2 G A 7: 130,198,481 T245M probably damaging Het
Gbp9 T A 5: 105,081,246 M512L probably benign Het
Glg1 T A 8: 111,165,639 K251I possibly damaging Het
Gm10553 A G 1: 85,100,420 D86G possibly damaging Het
Gm10767 A G 13: 66,907,205 probably benign Het
Gm5622 T C 14: 51,655,772 V52A probably benign Het
Gucy1b1 A G 3: 82,045,409 V239A probably benign Het
Gzma A G 13: 113,093,929 L246P probably damaging Het
Hibadh C A 6: 52,556,463 A223S probably benign Het
Hydin C A 8: 110,609,987 T5132N possibly damaging Het
Insrr A G 3: 87,814,513 N1198S probably damaging Het
Ivl T C 3: 92,572,113 E215G possibly damaging Het
Jmjd1c A G 10: 67,239,922 D2037G possibly damaging Het
Kcna3 G A 3: 107,037,672 C417Y probably damaging Het
Klra2 T C 6: 131,230,115 N177S probably benign Het
Llgl2 T C 11: 115,851,066 S645P probably damaging Het
Lrrc15 T C 16: 30,273,831 E230G probably benign Het
Magel2 C A 7: 62,378,415 Q356K possibly damaging Het
Mcm6 A G 1: 128,345,989 V368A probably benign Het
Myh8 G A 11: 67,279,004 V50M possibly damaging Het
Myrf A T 19: 10,218,190 F419I possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1330 G A 4: 118,893,340 V86M probably benign Het
Olfr556 A G 7: 102,670,477 M186V probably benign Het
Otud4 G A 8: 79,646,332 R93H probably damaging Het
Pank4 T A 4: 154,972,520 M390K probably benign Het
Pecam1 A G 11: 106,685,203 V401A probably damaging Het
Prdm6 C A 18: 53,536,724 T138K possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prpf8 A G 11: 75,496,511 E1206G possibly damaging Het
Prr30 A T 14: 101,197,941 I395N probably benign Het
Rab27a G A 9: 73,075,469 G19R probably damaging Het
Rrp12 A G 19: 41,892,590 V134A probably damaging Het
Scly A G 1: 91,305,394 T76A probably benign Het
Scube3 T C 17: 28,164,300 S439P possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sipa1l1 T C 12: 82,341,459 F153S probably damaging Het
Slc25a30 T G 14: 75,769,567 K163T possibly damaging Het
Slc26a8 T A 17: 28,644,640 D715V probably benign Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Smr2 C CT 5: 88,108,826 probably null Het
Sp6 T G 11: 97,022,114 S218A probably benign Het
Spata21 T C 4: 141,111,405 V589A probably damaging Het
Sycp2 T C 2: 178,402,800 I71V probably benign Het
Syne2 G T 12: 75,952,870 G2347C probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thbs4 A T 13: 92,769,571 N387K probably damaging Het
Tmem184a T C 5: 139,807,626 D216G probably damaging Het
Tprg T A 16: 25,317,348 S30T possibly damaging Het
Trip12 A T 1: 84,760,801 W778R probably damaging Het
Ttpa T C 4: 20,008,633 L65P probably damaging Het
Ush2a A T 1: 188,755,185 N3050I probably damaging Het
Xpot T C 10: 121,619,148 I30V probably benign Het
Zfp944 A G 17: 22,339,700 S189P probably benign Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0800:Fer1l4 UTSW 2 156045663 missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 156049478 critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3806:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4917:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5555:Fer1l4 UTSW 2 156048189 missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 156047865 critical splice donor site probably null
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
R7631:Fer1l4 UTSW 2 156048275 missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 156020431 missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 156048934 missense probably benign
R8021:Fer1l4 UTSW 2 156022591 missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 156045529 small deletion probably benign
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 156048429 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TACTCTTTCCCCGGGATGAC -3'
(R):5'- CCAGGACTTCCAGGTATGAC -3'

Sequencing Primer
(F):5'- GAACCAGCGACTTTGCATCCTG -3'
(R):5'- AGGACTTCCAGGTATGACTCTCAG -3'
Posted On2014-08-01