Incidental Mutation 'R1950:Kcna3'
ID217182
Institutional Source Beutler Lab
Gene Symbol Kcna3
Ensembl Gene ENSMUSG00000047959
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 3
SynonymsKv1.3, Mk-3, Kca1-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R1950 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107036169-107038070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107037672 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 417 (C417Y)
Ref Sequence ENSEMBL: ENSMUSP00000050680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052718]
Predicted Effect probably damaging
Transcript: ENSMUST00000052718
AA Change: C417Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050680
Gene: ENSMUSG00000047959
AA Change: C417Y

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
BTB 57 157 6.9e-10 SMART
Pfam:Ion_trans 186 444 4.2e-54 PFAM
Pfam:Ion_trans_2 352 437 2.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070085
SMART Domains Protein: ENSMUSP00000066165
Gene: ENSMUSG00000056145

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182414
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display no apparent immune system defects. Mice homozygous for a different knock-out allele show reduced body weight, increased basal metabolic rate, resistance to diet-induced obesity, increased insulin sensitivity, and altered peripheral glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 3,960,677 N478S probably damaging Het
Als2 T A 1: 59,185,601 probably null Het
Ankfy1 A G 11: 72,760,329 Y1035C probably damaging Het
Ankrd11 T C 8: 122,889,869 T2394A probably damaging Het
Axin1 G C 17: 26,193,964 G780R possibly damaging Het
Carm1 A T 9: 21,574,516 T127S probably benign Het
Ccdc73 T C 2: 104,926,935 I81T probably benign Het
Cdh12 T C 15: 21,237,879 Y67H probably damaging Het
Cfap65 C A 1: 74,907,660 G1297V probably damaging Het
Cfap74 T C 4: 155,427,430 probably null Het
Chit1 A G 1: 134,151,230 Y426C probably damaging Het
Clpp A G 17: 56,996,039 probably benign Het
Clrn3 T G 7: 135,514,084 Y179S possibly damaging Het
Cntn5 A C 9: 9,781,769 M635R probably damaging Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Ctla2b T C 13: 60,896,049 N102S possibly damaging Het
Cwf19l2 A T 9: 3,418,674 I154F probably benign Het
Cyhr1 A G 15: 76,659,217 probably null Het
Dffa C A 4: 149,104,382 S44R probably benign Het
Ehbp1 T A 11: 22,059,228 K930M probably damaging Het
Erc2 T A 14: 27,912,900 S473T probably damaging Het
Fam71f1 C T 6: 29,335,816 probably null Het
Fbxw24 A T 9: 109,605,413 L373H probably benign Het
Fer1l4 T C 2: 156,048,274 I244V probably damaging Het
Fgfr2 G A 7: 130,198,481 T245M probably damaging Het
Gbp9 T A 5: 105,081,246 M512L probably benign Het
Glg1 T A 8: 111,165,639 K251I possibly damaging Het
Gm10553 A G 1: 85,100,420 D86G possibly damaging Het
Gm10767 A G 13: 66,907,205 probably benign Het
Gm5622 T C 14: 51,655,772 V52A probably benign Het
Gucy1b1 A G 3: 82,045,409 V239A probably benign Het
Gzma A G 13: 113,093,929 L246P probably damaging Het
Hibadh C A 6: 52,556,463 A223S probably benign Het
Hydin C A 8: 110,609,987 T5132N possibly damaging Het
Insrr A G 3: 87,814,513 N1198S probably damaging Het
Ivl T C 3: 92,572,113 E215G possibly damaging Het
Jmjd1c A G 10: 67,239,922 D2037G possibly damaging Het
Klra2 T C 6: 131,230,115 N177S probably benign Het
Llgl2 T C 11: 115,851,066 S645P probably damaging Het
Lrrc15 T C 16: 30,273,831 E230G probably benign Het
Magel2 C A 7: 62,378,415 Q356K possibly damaging Het
Mcm6 A G 1: 128,345,989 V368A probably benign Het
Myh8 G A 11: 67,279,004 V50M possibly damaging Het
Myrf A T 19: 10,218,190 F419I possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1330 G A 4: 118,893,340 V86M probably benign Het
Olfr556 A G 7: 102,670,477 M186V probably benign Het
Otud4 G A 8: 79,646,332 R93H probably damaging Het
Pank4 T A 4: 154,972,520 M390K probably benign Het
Pecam1 A G 11: 106,685,203 V401A probably damaging Het
Prdm6 C A 18: 53,536,724 T138K possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prpf8 A G 11: 75,496,511 E1206G possibly damaging Het
Prr30 A T 14: 101,197,941 I395N probably benign Het
Rab27a G A 9: 73,075,469 G19R probably damaging Het
Rrp12 A G 19: 41,892,590 V134A probably damaging Het
Scly A G 1: 91,305,394 T76A probably benign Het
Scube3 T C 17: 28,164,300 S439P possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sipa1l1 T C 12: 82,341,459 F153S probably damaging Het
Slc25a30 T G 14: 75,769,567 K163T possibly damaging Het
Slc26a8 T A 17: 28,644,640 D715V probably benign Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Smr2 C CT 5: 88,108,826 probably null Het
Sp6 T G 11: 97,022,114 S218A probably benign Het
Spata21 T C 4: 141,111,405 V589A probably damaging Het
Sycp2 T C 2: 178,402,800 I71V probably benign Het
Syne2 G T 12: 75,952,870 G2347C probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thbs4 A T 13: 92,769,571 N387K probably damaging Het
Tmem184a T C 5: 139,807,626 D216G probably damaging Het
Tprg T A 16: 25,317,348 S30T possibly damaging Het
Trip12 A T 1: 84,760,801 W778R probably damaging Het
Ttpa T C 4: 20,008,633 L65P probably damaging Het
Ush2a A T 1: 188,755,185 N3050I probably damaging Het
Xpot T C 10: 121,619,148 I30V probably benign Het
Zfp944 A G 17: 22,339,700 S189P probably benign Het
Other mutations in Kcna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Kcna3 APN 3 107037156 missense probably benign 0.33
IGL00562:Kcna3 APN 3 107036730 missense probably damaging 1.00
IGL01106:Kcna3 APN 3 107037864 missense possibly damaging 0.89
IGL01318:Kcna3 APN 3 107037978 missense probably benign 0.03
IGL02253:Kcna3 APN 3 107037411 missense probably damaging 1.00
IGL03379:Kcna3 APN 3 107037205 missense probably benign 0.05
IGL02802:Kcna3 UTSW 3 107037053 missense probably damaging 0.99
IGL03014:Kcna3 UTSW 3 107037890 missense probably benign 0.00
R0393:Kcna3 UTSW 3 107036999 missense probably damaging 1.00
R1591:Kcna3 UTSW 3 107037029 missense probably damaging 1.00
R1922:Kcna3 UTSW 3 107037935 missense possibly damaging 0.47
R3847:Kcna3 UTSW 3 107036696 missense possibly damaging 0.57
R4912:Kcna3 UTSW 3 107037891 missense probably benign
R6261:Kcna3 UTSW 3 107037950 missense possibly damaging 0.53
R6271:Kcna3 UTSW 3 107037606 missense probably damaging 1.00
R6334:Kcna3 UTSW 3 107036424 start codon destroyed probably null
R6423:Kcna3 UTSW 3 107036842 nonsense probably null
R6850:Kcna3 UTSW 3 107037159 missense probably damaging 1.00
R6901:Kcna3 UTSW 3 107036568 missense probably benign 0.00
R7193:Kcna3 UTSW 3 107036537 missense probably benign 0.02
R7524:Kcna3 UTSW 3 107037207 missense probably damaging 1.00
Z1088:Kcna3 UTSW 3 107036953 missense probably damaging 1.00
Z1176:Kcna3 UTSW 3 107037266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGGACAGACGCTGAAG -3'
(R):5'- GAGTTACTCCGGGCTTTTCG -3'

Sequencing Primer
(F):5'- AGACGCTGAAGGCTTCCATG -3'
(R):5'- GGGCTTTTCGGAGCTCCTC -3'
Posted On2014-08-01