Incidental Mutation 'R1950:Cntn5'
ID217210
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1950 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 9781769 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 635 (M635R)
Ref Sequence ENSEMBL: ENSMUSP00000124327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect probably damaging
Transcript: ENSMUST00000074133
AA Change: M635R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: M635R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160216
AA Change: M635R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: M635R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162484
AA Change: M430R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: M430R

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179049
AA Change: M430R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: M430R

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 3,960,677 N478S probably damaging Het
Als2 T A 1: 59,185,601 probably null Het
Ankfy1 A G 11: 72,760,329 Y1035C probably damaging Het
Ankrd11 T C 8: 122,889,869 T2394A probably damaging Het
Axin1 G C 17: 26,193,964 G780R possibly damaging Het
Carm1 A T 9: 21,574,516 T127S probably benign Het
Ccdc73 T C 2: 104,926,935 I81T probably benign Het
Cdh12 T C 15: 21,237,879 Y67H probably damaging Het
Cfap65 C A 1: 74,907,660 G1297V probably damaging Het
Cfap74 T C 4: 155,427,430 probably null Het
Chit1 A G 1: 134,151,230 Y426C probably damaging Het
Clpp A G 17: 56,996,039 probably benign Het
Clrn3 T G 7: 135,514,084 Y179S possibly damaging Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Ctla2b T C 13: 60,896,049 N102S possibly damaging Het
Cwf19l2 A T 9: 3,418,674 I154F probably benign Het
Cyhr1 A G 15: 76,659,217 probably null Het
Dffa C A 4: 149,104,382 S44R probably benign Het
Ehbp1 T A 11: 22,059,228 K930M probably damaging Het
Erc2 T A 14: 27,912,900 S473T probably damaging Het
Fam71f1 C T 6: 29,335,816 probably null Het
Fbxw24 A T 9: 109,605,413 L373H probably benign Het
Fer1l4 T C 2: 156,048,274 I244V probably damaging Het
Fgfr2 G A 7: 130,198,481 T245M probably damaging Het
Gbp9 T A 5: 105,081,246 M512L probably benign Het
Glg1 T A 8: 111,165,639 K251I possibly damaging Het
Gm10553 A G 1: 85,100,420 D86G possibly damaging Het
Gm10767 A G 13: 66,907,205 probably benign Het
Gm5622 T C 14: 51,655,772 V52A probably benign Het
Gucy1b1 A G 3: 82,045,409 V239A probably benign Het
Gzma A G 13: 113,093,929 L246P probably damaging Het
Hibadh C A 6: 52,556,463 A223S probably benign Het
Hydin C A 8: 110,609,987 T5132N possibly damaging Het
Insrr A G 3: 87,814,513 N1198S probably damaging Het
Ivl T C 3: 92,572,113 E215G possibly damaging Het
Jmjd1c A G 10: 67,239,922 D2037G possibly damaging Het
Kcna3 G A 3: 107,037,672 C417Y probably damaging Het
Klra2 T C 6: 131,230,115 N177S probably benign Het
Llgl2 T C 11: 115,851,066 S645P probably damaging Het
Lrrc15 T C 16: 30,273,831 E230G probably benign Het
Magel2 C A 7: 62,378,415 Q356K possibly damaging Het
Mcm6 A G 1: 128,345,989 V368A probably benign Het
Myh8 G A 11: 67,279,004 V50M possibly damaging Het
Myrf A T 19: 10,218,190 F419I possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1330 G A 4: 118,893,340 V86M probably benign Het
Olfr556 A G 7: 102,670,477 M186V probably benign Het
Otud4 G A 8: 79,646,332 R93H probably damaging Het
Pank4 T A 4: 154,972,520 M390K probably benign Het
Pecam1 A G 11: 106,685,203 V401A probably damaging Het
Prdm6 C A 18: 53,536,724 T138K possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prpf8 A G 11: 75,496,511 E1206G possibly damaging Het
Prr30 A T 14: 101,197,941 I395N probably benign Het
Rab27a G A 9: 73,075,469 G19R probably damaging Het
Rrp12 A G 19: 41,892,590 V134A probably damaging Het
Scly A G 1: 91,305,394 T76A probably benign Het
Scube3 T C 17: 28,164,300 S439P possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sipa1l1 T C 12: 82,341,459 F153S probably damaging Het
Slc25a30 T G 14: 75,769,567 K163T possibly damaging Het
Slc26a8 T A 17: 28,644,640 D715V probably benign Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Smr2 C CT 5: 88,108,826 probably null Het
Sp6 T G 11: 97,022,114 S218A probably benign Het
Spata21 T C 4: 141,111,405 V589A probably damaging Het
Sycp2 T C 2: 178,402,800 I71V probably benign Het
Syne2 G T 12: 75,952,870 G2347C probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thbs4 A T 13: 92,769,571 N387K probably damaging Het
Tmem184a T C 5: 139,807,626 D216G probably damaging Het
Tprg T A 16: 25,317,348 S30T possibly damaging Het
Trip12 A T 1: 84,760,801 W778R probably damaging Het
Ttpa T C 4: 20,008,633 L65P probably damaging Het
Ush2a A T 1: 188,755,185 N3050I probably damaging Het
Xpot T C 10: 121,619,148 I30V probably benign Het
Zfp944 A G 17: 22,339,700 S189P probably benign Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1746:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3056:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4164:Cntn5 UTSW 9 9781676 missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10048771 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10904699 start gained probably benign
R7252:Cntn5 UTSW 9 9831635 missense probably benign 0.00
R7363:Cntn5 UTSW 9 10172016 missense probably benign 0.00
R7401:Cntn5 UTSW 9 9833461 missense probably benign 0.13
R7488:Cntn5 UTSW 9 9970565 missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9673410 intron probably null
R7662:Cntn5 UTSW 9 9661385 missense probably benign 0.17
R7718:Cntn5 UTSW 9 9984128 missense probably benign
R7719:Cntn5 UTSW 9 9704898 missense probably damaging 1.00
R7788:Cntn5 UTSW 9 9704929 missense probably benign 0.01
R7864:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R7947:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
Z1177:Cntn5 UTSW 9 9673962 nonsense probably null
Z1177:Cntn5 UTSW 9 10090236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCATCTCAAAGGCAAGAAAAGG -3'
(R):5'- TCCTTAAGACAGGGCGTGTTTG -3'

Sequencing Primer
(F):5'- TTATCAAAGTGAGCAGCGCAGTG -3'
(R):5'- CCTTAAGACAGGGCGTGTTTGATTTC -3'
Posted On2014-08-01