Incidental Mutation 'R1950:Sp6'
ID 217224
Institutional Source Beutler Lab
Gene Symbol Sp6
Ensembl Gene ENSMUSG00000038560
Gene Name trans-acting transcription factor 6
Synonyms Epfn, Klf14, epiprofin, 1110025J03Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R1950 (G1)
Quality Score 133
Status Not validated
Chromosome 11
Chromosomal Location 96904395-96915565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 96912940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 218 (S218A)
Ref Sequence ENSEMBL: ENSMUSP00000103248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047997] [ENSMUST00000107622]
AlphaFold Q9ESX2
Predicted Effect probably benign
Transcript: ENSMUST00000047997
AA Change: S218A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039307
Gene: ENSMUSG00000038560
AA Change: S218A

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107622
AA Change: S218A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103248
Gene: ENSMUSG00000038560
AA Change: S218A

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128111
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SP6 belongs to a family of transcription factors that contain 3 classical zinc finger DNA-binding domains consisting of a zinc atom tetrahedrally coordinated by 2 cysteines and 2 histidines (C2H2 motif). These transcription factors bind to GC-rich sequences and related GT and CACCC boxes (Scohy et al., 2000 [PubMed 11087666]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a disruption at this locus display impaired skin, hair follicle, tooth and lung development as well as limb abnormalities and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,010,677 (GRCm39) N478S probably damaging Het
Als2 T A 1: 59,224,760 (GRCm39) probably null Het
Ankfy1 A G 11: 72,651,155 (GRCm39) Y1035C probably damaging Het
Ankrd11 T C 8: 123,616,608 (GRCm39) T2394A probably damaging Het
Axin1 G C 17: 26,412,938 (GRCm39) G780R possibly damaging Het
Carm1 A T 9: 21,485,812 (GRCm39) T127S probably benign Het
Ccdc73 T C 2: 104,757,280 (GRCm39) I81T probably benign Het
Cdh12 T C 15: 21,237,965 (GRCm39) Y67H probably damaging Het
Cfap65 C A 1: 74,946,819 (GRCm39) G1297V probably damaging Het
Cfap74 T C 4: 155,511,887 (GRCm39) probably null Het
Chit1 A G 1: 134,078,968 (GRCm39) Y426C probably damaging Het
Clpp A G 17: 57,303,039 (GRCm39) probably benign Het
Clrn3 T G 7: 135,115,813 (GRCm39) Y179S possibly damaging Het
Cntn5 A C 9: 9,781,774 (GRCm39) M635R probably damaging Het
Col12a1 A T 9: 79,537,831 (GRCm39) S2546T possibly damaging Het
Ctla2b T C 13: 61,043,863 (GRCm39) N102S possibly damaging Het
Cwf19l2 A T 9: 3,418,674 (GRCm39) I154F probably benign Het
Dffa C A 4: 149,188,839 (GRCm39) S44R probably benign Het
Ehbp1 T A 11: 22,009,228 (GRCm39) K930M probably damaging Het
Erc2 T A 14: 27,634,857 (GRCm39) S473T probably damaging Het
Fbxw24 A T 9: 109,434,481 (GRCm39) L373H probably benign Het
Fer1l4 T C 2: 155,890,194 (GRCm39) I244V probably damaging Het
Fgfr2 G A 7: 129,800,211 (GRCm39) T245M probably damaging Het
Garin1b C T 6: 29,335,815 (GRCm39) probably null Het
Gbp9 T A 5: 105,229,112 (GRCm39) M512L probably benign Het
Glg1 T A 8: 111,892,271 (GRCm39) K251I possibly damaging Het
Gm10553 A G 1: 85,078,141 (GRCm39) D86G possibly damaging Het
Gm5622 T C 14: 51,893,229 (GRCm39) V52A probably benign Het
Gucy1b1 A G 3: 81,952,716 (GRCm39) V239A probably benign Het
Gzma A G 13: 113,230,463 (GRCm39) L246P probably damaging Het
Hibadh C A 6: 52,533,448 (GRCm39) A223S probably benign Het
Hydin C A 8: 111,336,619 (GRCm39) T5132N possibly damaging Het
Insrr A G 3: 87,721,820 (GRCm39) N1198S probably damaging Het
Ivl T C 3: 92,479,420 (GRCm39) E215G possibly damaging Het
Jmjd1c A G 10: 67,075,701 (GRCm39) D2037G possibly damaging Het
Kcna3 G A 3: 106,944,988 (GRCm39) C417Y probably damaging Het
Klra2 T C 6: 131,207,078 (GRCm39) N177S probably benign Het
Llgl2 T C 11: 115,741,892 (GRCm39) S645P probably damaging Het
Lrrc15 T C 16: 30,092,649 (GRCm39) E230G probably benign Het
Magel2 C A 7: 62,028,163 (GRCm39) Q356K possibly damaging Het
Mcm6 A G 1: 128,273,726 (GRCm39) V368A probably benign Het
Myh8 G A 11: 67,169,830 (GRCm39) V50M possibly damaging Het
Myrf A T 19: 10,195,554 (GRCm39) F419I possibly damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Or10ak16 G A 4: 118,750,537 (GRCm39) V86M probably benign Het
Or52i2 A G 7: 102,319,684 (GRCm39) M186V probably benign Het
Otud4 G A 8: 80,372,961 (GRCm39) R93H probably damaging Het
Pank4 T A 4: 155,056,977 (GRCm39) M390K probably benign Het
Pecam1 A G 11: 106,576,029 (GRCm39) V401A probably damaging Het
Prdm6 C A 18: 53,669,796 (GRCm39) T138K possibly damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Prpf8 A G 11: 75,387,337 (GRCm39) E1206G possibly damaging Het
Prr30 A T 14: 101,435,377 (GRCm39) I395N probably benign Het
Rab27a G A 9: 72,982,751 (GRCm39) G19R probably damaging Het
Ramacl A G 13: 67,055,269 (GRCm39) probably benign Het
Rrp12 A G 19: 41,881,029 (GRCm39) V134A probably damaging Het
Scly A G 1: 91,233,116 (GRCm39) T76A probably benign Het
Scube3 T C 17: 28,383,274 (GRCm39) S439P possibly damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Sipa1l1 T C 12: 82,388,233 (GRCm39) F153S probably damaging Het
Slc25a30 T G 14: 76,007,007 (GRCm39) K163T possibly damaging Het
Slc26a8 T A 17: 28,863,614 (GRCm39) D715V probably benign Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Smr2 C CT 5: 88,256,685 (GRCm39) probably null Het
Spata21 T C 4: 140,838,716 (GRCm39) V589A probably damaging Het
Sycp2 T C 2: 178,044,593 (GRCm39) I71V probably benign Het
Syne2 G T 12: 75,999,644 (GRCm39) G2347C probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Thbs4 A T 13: 92,906,079 (GRCm39) N387K probably damaging Het
Tmem184a T C 5: 139,793,381 (GRCm39) D216G probably damaging Het
Tprg1 T A 16: 25,136,098 (GRCm39) S30T possibly damaging Het
Trip12 A T 1: 84,738,522 (GRCm39) W778R probably damaging Het
Ttpa T C 4: 20,008,633 (GRCm39) L65P probably damaging Het
Ush2a A T 1: 188,487,382 (GRCm39) N3050I probably damaging Het
Xpot T C 10: 121,455,053 (GRCm39) I30V probably benign Het
Zfp944 A G 17: 22,558,681 (GRCm39) S189P probably benign Het
Zftraf1 A G 15: 76,543,417 (GRCm39) probably null Het
Other mutations in Sp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sp6 APN 11 96,913,429 (GRCm39) utr 3 prime probably benign
R0281:Sp6 UTSW 11 96,912,751 (GRCm39) missense probably benign 0.24
R0326:Sp6 UTSW 11 96,912,361 (GRCm39) missense possibly damaging 0.90
R0584:Sp6 UTSW 11 96,913,091 (GRCm39) missense probably damaging 1.00
R0678:Sp6 UTSW 11 96,912,607 (GRCm39) missense probably damaging 0.99
R0690:Sp6 UTSW 11 96,912,370 (GRCm39) missense possibly damaging 0.89
R1909:Sp6 UTSW 11 96,912,334 (GRCm39) missense probably benign 0.04
R3697:Sp6 UTSW 11 96,912,580 (GRCm39) missense possibly damaging 0.86
R4380:Sp6 UTSW 11 96,912,572 (GRCm39) missense probably damaging 0.98
R4666:Sp6 UTSW 11 96,912,701 (GRCm39) missense probably benign 0.19
R8701:Sp6 UTSW 11 96,913,090 (GRCm39) missense probably damaging 1.00
X0011:Sp6 UTSW 11 96,913,351 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCTTTGGGAGGATACGTC -3'
(R):5'- AACTTCTTGGTCCCGGTGTG -3'

Sequencing Primer
(F):5'- TCGGAGACCATCAGCTCTGTG -3'
(R):5'- TTGCCGCAGAAAAGCCAGTTG -3'
Posted On 2014-08-01