Incidental Mutation 'R1950:Slc26a8'
ID217252
Institutional Source Beutler Lab
Gene Symbol Slc26a8
Ensembl Gene ENSMUSG00000036196
Gene Namesolute carrier family 26, member 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R1950 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28637783-28689987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28644640 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 715 (D715V)
Ref Sequence ENSEMBL: ENSMUSP00000110412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114764]
Predicted Effect probably benign
Transcript: ENSMUST00000114764
AA Change: D715V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110412
Gene: ENSMUSG00000036196
AA Change: D715V

DomainStartEndE-ValueType
Pfam:Sulfate_transp 90 491 1.2e-72 PFAM
low complexity region 494 509 N/A INTRINSIC
Pfam:STAS 542 792 7.3e-16 PFAM
low complexity region 881 896 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26 gene family of anion transporters. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. The expression of this gene appears to be restricted to spermatocytes. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit male sterility associated with sperm immotility, abnormal flagella and reduced acrosomal reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 3,960,677 N478S probably damaging Het
Als2 T A 1: 59,185,601 probably null Het
Ankfy1 A G 11: 72,760,329 Y1035C probably damaging Het
Ankrd11 T C 8: 122,889,869 T2394A probably damaging Het
Axin1 G C 17: 26,193,964 G780R possibly damaging Het
Carm1 A T 9: 21,574,516 T127S probably benign Het
Ccdc73 T C 2: 104,926,935 I81T probably benign Het
Cdh12 T C 15: 21,237,879 Y67H probably damaging Het
Cfap65 C A 1: 74,907,660 G1297V probably damaging Het
Cfap74 T C 4: 155,427,430 probably null Het
Chit1 A G 1: 134,151,230 Y426C probably damaging Het
Clpp A G 17: 56,996,039 probably benign Het
Clrn3 T G 7: 135,514,084 Y179S possibly damaging Het
Cntn5 A C 9: 9,781,769 M635R probably damaging Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Ctla2b T C 13: 60,896,049 N102S possibly damaging Het
Cwf19l2 A T 9: 3,418,674 I154F probably benign Het
Cyhr1 A G 15: 76,659,217 probably null Het
Dffa C A 4: 149,104,382 S44R probably benign Het
Ehbp1 T A 11: 22,059,228 K930M probably damaging Het
Erc2 T A 14: 27,912,900 S473T probably damaging Het
Fam71f1 C T 6: 29,335,816 probably null Het
Fbxw24 A T 9: 109,605,413 L373H probably benign Het
Fer1l4 T C 2: 156,048,274 I244V probably damaging Het
Fgfr2 G A 7: 130,198,481 T245M probably damaging Het
Gbp9 T A 5: 105,081,246 M512L probably benign Het
Glg1 T A 8: 111,165,639 K251I possibly damaging Het
Gm10553 A G 1: 85,100,420 D86G possibly damaging Het
Gm10767 A G 13: 66,907,205 probably benign Het
Gm5622 T C 14: 51,655,772 V52A probably benign Het
Gucy1b1 A G 3: 82,045,409 V239A probably benign Het
Gzma A G 13: 113,093,929 L246P probably damaging Het
Hibadh C A 6: 52,556,463 A223S probably benign Het
Hydin C A 8: 110,609,987 T5132N possibly damaging Het
Insrr A G 3: 87,814,513 N1198S probably damaging Het
Ivl T C 3: 92,572,113 E215G possibly damaging Het
Jmjd1c A G 10: 67,239,922 D2037G possibly damaging Het
Kcna3 G A 3: 107,037,672 C417Y probably damaging Het
Klra2 T C 6: 131,230,115 N177S probably benign Het
Llgl2 T C 11: 115,851,066 S645P probably damaging Het
Lrrc15 T C 16: 30,273,831 E230G probably benign Het
Magel2 C A 7: 62,378,415 Q356K possibly damaging Het
Mcm6 A G 1: 128,345,989 V368A probably benign Het
Myh8 G A 11: 67,279,004 V50M possibly damaging Het
Myrf A T 19: 10,218,190 F419I possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1330 G A 4: 118,893,340 V86M probably benign Het
Olfr556 A G 7: 102,670,477 M186V probably benign Het
Otud4 G A 8: 79,646,332 R93H probably damaging Het
Pank4 T A 4: 154,972,520 M390K probably benign Het
Pecam1 A G 11: 106,685,203 V401A probably damaging Het
Prdm6 C A 18: 53,536,724 T138K possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prpf8 A G 11: 75,496,511 E1206G possibly damaging Het
Prr30 A T 14: 101,197,941 I395N probably benign Het
Rab27a G A 9: 73,075,469 G19R probably damaging Het
Rrp12 A G 19: 41,892,590 V134A probably damaging Het
Scly A G 1: 91,305,394 T76A probably benign Het
Scube3 T C 17: 28,164,300 S439P possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sipa1l1 T C 12: 82,341,459 F153S probably damaging Het
Slc25a30 T G 14: 75,769,567 K163T possibly damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Smr2 C CT 5: 88,108,826 probably null Het
Sp6 T G 11: 97,022,114 S218A probably benign Het
Spata21 T C 4: 141,111,405 V589A probably damaging Het
Sycp2 T C 2: 178,402,800 I71V probably benign Het
Syne2 G T 12: 75,952,870 G2347C probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thbs4 A T 13: 92,769,571 N387K probably damaging Het
Tmem184a T C 5: 139,807,626 D216G probably damaging Het
Tprg T A 16: 25,317,348 S30T possibly damaging Het
Trip12 A T 1: 84,760,801 W778R probably damaging Het
Ttpa T C 4: 20,008,633 L65P probably damaging Het
Ush2a A T 1: 188,755,185 N3050I probably damaging Het
Xpot T C 10: 121,619,148 I30V probably benign Het
Zfp944 A G 17: 22,339,700 S189P probably benign Het
Other mutations in Slc26a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc26a8 APN 17 28654948 missense probably benign 0.01
IGL02041:Slc26a8 APN 17 28642251 missense probably damaging 1.00
IGL02389:Slc26a8 APN 17 28638650 missense probably benign 0.00
E0370:Slc26a8 UTSW 17 28642387 missense possibly damaging 0.77
FR4449:Slc26a8 UTSW 17 28638316 small deletion probably benign
R1028:Slc26a8 UTSW 17 28672798 missense probably damaging 1.00
R1445:Slc26a8 UTSW 17 28648213 missense possibly damaging 0.72
R1501:Slc26a8 UTSW 17 28638562 missense possibly damaging 0.73
R1606:Slc26a8 UTSW 17 28638481 missense possibly damaging 0.73
R1819:Slc26a8 UTSW 17 28684834 missense probably benign 0.31
R1973:Slc26a8 UTSW 17 28663605 missense probably benign 0.01
R2203:Slc26a8 UTSW 17 28648007 missense probably benign 0.06
R3912:Slc26a8 UTSW 17 28644779 missense possibly damaging 0.92
R4176:Slc26a8 UTSW 17 28647999 missense probably benign 0.04
R4539:Slc26a8 UTSW 17 28659617 missense probably benign 0.00
R4661:Slc26a8 UTSW 17 28638684 missense probably benign 0.04
R4766:Slc26a8 UTSW 17 28638661 missense probably benign 0.01
R4850:Slc26a8 UTSW 17 28654883 missense probably benign 0.01
R4867:Slc26a8 UTSW 17 28663634 missense probably benign 0.05
R5521:Slc26a8 UTSW 17 28654859 missense probably benign 0.10
R5713:Slc26a8 UTSW 17 28661879 missense probably benign 0.01
R6092:Slc26a8 UTSW 17 28648155 missense probably damaging 1.00
R6135:Slc26a8 UTSW 17 28669940 missense probably benign 0.00
R6372:Slc26a8 UTSW 17 28644803 missense probably benign 0.08
R6543:Slc26a8 UTSW 17 28638401 missense possibly damaging 0.53
R6590:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6690:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6866:Slc26a8 UTSW 17 28638481 missense probably benign 0.27
R7057:Slc26a8 UTSW 17 28638397 missense possibly damaging 0.72
R7423:Slc26a8 UTSW 17 28648203 missense probably benign 0.32
R7496:Slc26a8 UTSW 17 28644850 missense probably benign 0.20
RF015:Slc26a8 UTSW 17 28638341 small deletion probably benign
Z1177:Slc26a8 UTSW 17 28638165 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACTGAGCAATCCCACGATG -3'
(R):5'- GCCAAGTCACTTCTGAGGAACAG -3'

Sequencing Primer
(F):5'- TGAGCAATCCCACGATGCAAAG -3'
(R):5'- GAACAGATTCCCTACACAGTGTCTTC -3'
Posted On2014-08-01