Incidental Mutation 'R1951:Olfr1167'
ID217266
Institutional Source Beutler Lab
Gene Symbol Olfr1167
Ensembl Gene ENSMUSG00000100899
Gene Nameolfactory receptor 1167
SynonymsMOR174-16, GA_x6K02T2Q125-49641892-49640942
MMRRC Submission 039965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1951 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88146150-88155193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88149297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 241 (S241P)
Ref Sequence ENSEMBL: ENSMUSP00000149599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099832] [ENSMUST00000216951]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099832
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097420
Gene: ENSMUSG00000100899
AA Change: S241P

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.3e-47 PFAM
Pfam:7tm_1 43 292 3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216951
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Adcy3 T C 12: 4,208,624 F847S probably benign Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Arhgap28 G A 17: 67,901,341 A44V probably benign Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Baz1b T A 5: 135,216,739 N347K probably benign Het
Best2 T A 8: 85,011,229 N179I possibly damaging Het
Bfar C T 16: 13,702,106 S276L probably damaging Het
Bloc1s3 A G 7: 19,507,558 V15A possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Calhm3 A G 19: 47,151,817 L279P probably benign Het
Cand1 A T 10: 119,208,020 probably benign Het
Car15 T C 16: 17,837,405 D57G possibly damaging Het
Casp12 G A 9: 5,348,959 probably null Het
Cd93 T C 2: 148,441,858 T523A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckap5 A G 2: 91,556,492 probably benign Het
Col6a5 G A 9: 105,936,957 R619W unknown Het
Colec12 G A 18: 9,859,975 probably null Het
Crmp1 G A 5: 37,273,355 V222I possibly damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Ctbp2 A G 7: 133,015,027 S60P probably benign Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dhx36 T C 3: 62,484,273 I551V probably damaging Het
Dlg5 T A 14: 24,156,469 probably benign Het
Dlgap1 A T 17: 70,761,311 I300F probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah6 T A 6: 73,084,721 R2794* probably null Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgl1 G T 8: 41,197,350 F187L probably benign Het
Fras1 T A 5: 96,712,383 V2096E probably benign Het
Gm10647 A G 9: 66,798,480 probably benign Het
Gm14226 G A 2: 155,024,335 D71N possibly damaging Het
Grip2 A T 6: 91,783,848 I284N probably damaging Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itgal A G 7: 127,330,145 D1078G probably damaging Het
Khdc3 T C 9: 73,103,237 V123A possibly damaging Het
Klhl13 A G X: 23,261,581 probably benign Het
Klhl42 T C 6: 147,091,823 S98P probably damaging Het
Lrp5 T C 19: 3,620,298 N602S possibly damaging Het
Lrrd1 A T 5: 3,851,488 I598F probably damaging Het
Ltbp1 A G 17: 75,151,377 T318A probably benign Het
Mfsd6 A G 1: 52,709,358 F116S probably damaging Het
Ncam1 T C 9: 49,545,192 I486V probably benign Het
Nptx1 A G 11: 119,543,180 probably null Het
Nrg1 T C 8: 31,918,193 Y4C probably damaging Het
Nsf G A 11: 103,882,876 R271* probably null Het
Olfr1049 G C 2: 86,255,096 T199S probably benign Het
Olfr1053 T A 2: 86,315,160 N42I probably damaging Het
Olfr1058 A T 2: 86,385,511 H302Q probably benign Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pdia4 A G 6: 47,803,879 Y212H probably damaging Het
Pgr A G 9: 8,946,953 probably benign Het
Pitpnm3 G T 11: 72,074,624 H112N possibly damaging Het
Ppargc1b G T 18: 61,298,777 T1000K possibly damaging Het
Psd3 C A 8: 67,963,487 C586F probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rabep2 A T 7: 126,438,564 R169S possibly damaging Het
Rad21l T C 2: 151,655,259 R309G probably benign Het
Rbm12 T C 2: 156,097,213 R380G probably damaging Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc12a2 A G 18: 57,879,395 T197A possibly damaging Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Sptbn4 T C 7: 27,366,443 E2026G possibly damaging Het
Srf A T 17: 46,551,707 M285K possibly damaging Het
Tanc1 T C 2: 59,791,812 V425A possibly damaging Het
Tle4 A T 19: 14,516,357 probably null Het
Tmem132e A G 11: 82,445,082 R905G possibly damaging Het
Tmem200c A T 17: 68,840,988 I189F probably damaging Het
Trappc13 T C 13: 104,174,642 Q87R probably benign Het
Trpm7 A T 2: 126,831,299 D511E probably damaging Het
Ttc30b A G 2: 75,937,242 L389P probably damaging Het
Ttn A T 2: 76,802,290 I14140N possibly damaging Het
Virma A G 4: 11,513,907 D587G probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r68 A G 7: 85,233,894 F217L probably damaging Het
Vps13c T C 9: 67,973,759 probably null Het
Vrtn T C 12: 84,649,199 V241A probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Olfr1167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Olfr1167 APN 2 88149260 missense possibly damaging 0.55
IGL01525:Olfr1167 APN 2 88149877 missense probably benign 0.15
IGL02008:Olfr1167 APN 2 88149578 missense probably damaging 1.00
IGL02116:Olfr1167 APN 2 88149288 missense probably benign 0.03
IGL02740:Olfr1167 APN 2 88149257 missense probably damaging 1.00
IGL03493:Olfr1167 APN 2 88149936 missense probably benign 0.02
PIT4498001:Olfr1167 UTSW 2 88149915 missense probably benign 0.00
R2060:Olfr1167 UTSW 2 88149143 missense probably damaging 1.00
R4167:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4168:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4244:Olfr1167 UTSW 2 88149288 missense probably benign 0.00
R5363:Olfr1167 UTSW 2 88149802 missense probably damaging 1.00
R5778:Olfr1167 UTSW 2 88149617 missense probably damaging 1.00
R5939:Olfr1167 UTSW 2 88149509 missense probably damaging 1.00
R6502:Olfr1167 UTSW 2 88150016 start codon destroyed probably null 0.37
R7036:Olfr1167 UTSW 2 88149125 missense probably damaging 0.99
R7104:Olfr1167 UTSW 2 88149372 missense possibly damaging 0.65
R7340:Olfr1167 UTSW 2 88149276 missense possibly damaging 0.95
R7481:Olfr1167 UTSW 2 88149761 missense probably benign 0.12
R7615:Olfr1167 UTSW 2 88149518 missense probably benign 0.01
X0050:Olfr1167 UTSW 2 88149696 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTTTGAGCTGATAAGTCTCCTGAC -3'
(R):5'- ACTTTGGCTGTGAATACTCTGC -3'

Sequencing Primer
(F):5'- GTCCTTCACATCTTTATTTCTAAGGC -3'
(R):5'- GGCTGTGAATACTCTGCTGTCATC -3'
Posted On2014-08-01