Incidental Mutation 'R1951:Vmn2r68'
ID217293
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission 039965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1951 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85233894 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 217 (F217L)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect probably damaging
Transcript: ENSMUST00000061074
AA Change: F217L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: F217L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (84/86)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Adcy3 T C 12: 4,208,624 F847S probably benign Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Arhgap28 G A 17: 67,901,341 A44V probably benign Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Baz1b T A 5: 135,216,739 N347K probably benign Het
Best2 T A 8: 85,011,229 N179I possibly damaging Het
Bfar C T 16: 13,702,106 S276L probably damaging Het
Bloc1s3 A G 7: 19,507,558 V15A possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Calhm3 A G 19: 47,151,817 L279P probably benign Het
Cand1 A T 10: 119,208,020 probably benign Het
Car15 T C 16: 17,837,405 D57G possibly damaging Het
Casp12 G A 9: 5,348,959 probably null Het
Cd93 T C 2: 148,441,858 T523A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckap5 A G 2: 91,556,492 probably benign Het
Col6a5 G A 9: 105,936,957 R619W unknown Het
Colec12 G A 18: 9,859,975 probably null Het
Crmp1 G A 5: 37,273,355 V222I possibly damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Ctbp2 A G 7: 133,015,027 S60P probably benign Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dhx36 T C 3: 62,484,273 I551V probably damaging Het
Dlg5 T A 14: 24,156,469 probably benign Het
Dlgap1 A T 17: 70,761,311 I300F probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah6 T A 6: 73,084,721 R2794* probably null Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgl1 G T 8: 41,197,350 F187L probably benign Het
Fras1 T A 5: 96,712,383 V2096E probably benign Het
Gm10647 A G 9: 66,798,480 probably benign Het
Gm14226 G A 2: 155,024,335 D71N possibly damaging Het
Grip2 A T 6: 91,783,848 I284N probably damaging Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itgal A G 7: 127,330,145 D1078G probably damaging Het
Khdc3 T C 9: 73,103,237 V123A possibly damaging Het
Klhl13 A G X: 23,261,581 probably benign Het
Klhl42 T C 6: 147,091,823 S98P probably damaging Het
Lrp5 T C 19: 3,620,298 N602S possibly damaging Het
Lrrd1 A T 5: 3,851,488 I598F probably damaging Het
Ltbp1 A G 17: 75,151,377 T318A probably benign Het
Mfsd6 A G 1: 52,709,358 F116S probably damaging Het
Ncam1 T C 9: 49,545,192 I486V probably benign Het
Nptx1 A G 11: 119,543,180 probably null Het
Nrg1 T C 8: 31,918,193 Y4C probably damaging Het
Nsf G A 11: 103,882,876 R271* probably null Het
Olfr1049 G C 2: 86,255,096 T199S probably benign Het
Olfr1053 T A 2: 86,315,160 N42I probably damaging Het
Olfr1058 A T 2: 86,385,511 H302Q probably benign Het
Olfr1167 A G 2: 88,149,297 S241P possibly damaging Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pdia4 A G 6: 47,803,879 Y212H probably damaging Het
Pgr A G 9: 8,946,953 probably benign Het
Pitpnm3 G T 11: 72,074,624 H112N possibly damaging Het
Ppargc1b G T 18: 61,298,777 T1000K possibly damaging Het
Psd3 C A 8: 67,963,487 C586F probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rabep2 A T 7: 126,438,564 R169S possibly damaging Het
Rad21l T C 2: 151,655,259 R309G probably benign Het
Rbm12 T C 2: 156,097,213 R380G probably damaging Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc12a2 A G 18: 57,879,395 T197A possibly damaging Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Sptbn4 T C 7: 27,366,443 E2026G possibly damaging Het
Srf A T 17: 46,551,707 M285K possibly damaging Het
Tanc1 T C 2: 59,791,812 V425A possibly damaging Het
Tle4 A T 19: 14,516,357 probably null Het
Tmem132e A G 11: 82,445,082 R905G possibly damaging Het
Tmem200c A T 17: 68,840,988 I189F probably damaging Het
Trappc13 T C 13: 104,174,642 Q87R probably benign Het
Trpm7 A T 2: 126,831,299 D511E probably damaging Het
Ttc30b A G 2: 75,937,242 L389P probably damaging Het
Ttn A T 2: 76,802,290 I14140N possibly damaging Het
Virma A G 4: 11,513,907 D587G probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vps13c T C 9: 67,973,759 probably null Het
Vrtn T C 12: 84,649,199 V241A probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGAGGTGTAGTCTCCATACAC -3'
(R):5'- TAGAATGAATACCCTCAGGTCAAAC -3'

Sequencing Primer
(F):5'- GAGGTGTAGTCTCCATACACTATCAC -3'
(R):5'- ACACACTCTACATCATTGCCTATG -3'
Posted On2014-08-01