Incidental Mutation 'R1951:Abca15'
ID217294
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
MMRRC Submission 039965-MU
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1951 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120361432 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 706 (R706C)
Ref Sequence ENSEMBL: ENSMUSP00000112821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect probably damaging
Transcript: ENSMUST00000076272
AA Change: R706C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: R706C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121265
AA Change: R706C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: R706C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140459
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (84/86)
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T C 12: 4,208,624 F847S probably benign Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Arhgap28 G A 17: 67,901,341 A44V probably benign Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Baz1b T A 5: 135,216,739 N347K probably benign Het
Best2 T A 8: 85,011,229 N179I possibly damaging Het
Bfar C T 16: 13,702,106 S276L probably damaging Het
Bloc1s3 A G 7: 19,507,558 V15A possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Calhm3 A G 19: 47,151,817 L279P probably benign Het
Cand1 A T 10: 119,208,020 probably benign Het
Car15 T C 16: 17,837,405 D57G possibly damaging Het
Casp12 G A 9: 5,348,959 probably null Het
Cd93 T C 2: 148,441,858 T523A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckap5 A G 2: 91,556,492 probably benign Het
Col6a5 G A 9: 105,936,957 R619W unknown Het
Colec12 G A 18: 9,859,975 probably null Het
Crmp1 G A 5: 37,273,355 V222I possibly damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Ctbp2 A G 7: 133,015,027 S60P probably benign Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dhx36 T C 3: 62,484,273 I551V probably damaging Het
Dlg5 T A 14: 24,156,469 probably benign Het
Dlgap1 A T 17: 70,761,311 I300F probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah6 T A 6: 73,084,721 R2794* probably null Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgl1 G T 8: 41,197,350 F187L probably benign Het
Fras1 T A 5: 96,712,383 V2096E probably benign Het
Gm10647 A G 9: 66,798,480 probably benign Het
Gm14226 G A 2: 155,024,335 D71N possibly damaging Het
Grip2 A T 6: 91,783,848 I284N probably damaging Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itgal A G 7: 127,330,145 D1078G probably damaging Het
Khdc3 T C 9: 73,103,237 V123A possibly damaging Het
Klhl13 A G X: 23,261,581 probably benign Het
Klhl42 T C 6: 147,091,823 S98P probably damaging Het
Lrp5 T C 19: 3,620,298 N602S possibly damaging Het
Lrrd1 A T 5: 3,851,488 I598F probably damaging Het
Ltbp1 A G 17: 75,151,377 T318A probably benign Het
Mfsd6 A G 1: 52,709,358 F116S probably damaging Het
Ncam1 T C 9: 49,545,192 I486V probably benign Het
Nptx1 A G 11: 119,543,180 probably null Het
Nrg1 T C 8: 31,918,193 Y4C probably damaging Het
Nsf G A 11: 103,882,876 R271* probably null Het
Olfr1049 G C 2: 86,255,096 T199S probably benign Het
Olfr1053 T A 2: 86,315,160 N42I probably damaging Het
Olfr1058 A T 2: 86,385,511 H302Q probably benign Het
Olfr1167 A G 2: 88,149,297 S241P possibly damaging Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pdia4 A G 6: 47,803,879 Y212H probably damaging Het
Pgr A G 9: 8,946,953 probably benign Het
Pitpnm3 G T 11: 72,074,624 H112N possibly damaging Het
Ppargc1b G T 18: 61,298,777 T1000K possibly damaging Het
Psd3 C A 8: 67,963,487 C586F probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rabep2 A T 7: 126,438,564 R169S possibly damaging Het
Rad21l T C 2: 151,655,259 R309G probably benign Het
Rbm12 T C 2: 156,097,213 R380G probably damaging Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc12a2 A G 18: 57,879,395 T197A possibly damaging Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Sptbn4 T C 7: 27,366,443 E2026G possibly damaging Het
Srf A T 17: 46,551,707 M285K possibly damaging Het
Tanc1 T C 2: 59,791,812 V425A possibly damaging Het
Tle4 A T 19: 14,516,357 probably null Het
Tmem132e A G 11: 82,445,082 R905G possibly damaging Het
Tmem200c A T 17: 68,840,988 I189F probably damaging Het
Trappc13 T C 13: 104,174,642 Q87R probably benign Het
Trpm7 A T 2: 126,831,299 D511E probably damaging Het
Ttc30b A G 2: 75,937,242 L389P probably damaging Het
Ttn A T 2: 76,802,290 I14140N possibly damaging Het
Virma A G 4: 11,513,907 D587G probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r68 A G 7: 85,233,894 F217L probably damaging Het
Vps13c T C 9: 67,973,759 probably null Het
Vrtn T C 12: 84,649,199 V241A probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCAAGAGCAAGCCTAGTACTGG -3'
(R):5'- CTTGCAGCTGAATGTTAGTTGAAC -3'

Sequencing Primer
(F):5'- CAAGCCTAGTACTGGTAGGAGCC -3'
(R):5'- GTTGAACACAGCATAATGAATCAGTC -3'
Posted On2014-08-01