Incidental Mutation 'R1951:Pgr'
ID217307
Institutional Source Beutler Lab
Gene Symbol Pgr
Ensembl Gene ENSMUSG00000031870
Gene Nameprogesterone receptor
Synonyms9930019P03Rik, ENSMUSG00000074510, PR-A, PR-B, PR, NR3C3
MMRRC Submission 039965-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R1951 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location8899833-8968611 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 8946953 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070463] [ENSMUST00000098986] [ENSMUST00000189181]
Predicted Effect probably benign
Transcript: ENSMUST00000070463
SMART Domains Protein: ENSMUSP00000063562
Gene: ENSMUSG00000031870

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098986
SMART Domains Protein: ENSMUSP00000096584
Gene: ENSMUSG00000031870

DomainStartEndE-ValueType
low complexity region 79 100 N/A INTRINSIC
low complexity region 172 189 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
low complexity region 269 289 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C4 392 463 1.29e-29 SMART
low complexity region 538 546 N/A INTRINSIC
HOLI 548 712 3.21e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151080
Predicted Effect probably benign
Transcript: ENSMUST00000189181
SMART Domains Protein: ENSMUSP00000140124
Gene: ENSMUSG00000031870

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null female mice are sterile and exhibit ovulatory defects, uterine hyperplasia, and impaired mammary development. Females lacking only isoform A are infertile but show normal mammary development, while females lacking only isoform B are fertile but present with mammary developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Adcy3 T C 12: 4,208,624 F847S probably benign Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Arhgap28 G A 17: 67,901,341 A44V probably benign Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Baz1b T A 5: 135,216,739 N347K probably benign Het
Best2 T A 8: 85,011,229 N179I possibly damaging Het
Bfar C T 16: 13,702,106 S276L probably damaging Het
Bloc1s3 A G 7: 19,507,558 V15A possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Calhm3 A G 19: 47,151,817 L279P probably benign Het
Cand1 A T 10: 119,208,020 probably benign Het
Car15 T C 16: 17,837,405 D57G possibly damaging Het
Casp12 G A 9: 5,348,959 probably null Het
Cd93 T C 2: 148,441,858 T523A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckap5 A G 2: 91,556,492 probably benign Het
Col6a5 G A 9: 105,936,957 R619W unknown Het
Colec12 G A 18: 9,859,975 probably null Het
Crmp1 G A 5: 37,273,355 V222I possibly damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Ctbp2 A G 7: 133,015,027 S60P probably benign Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dhx36 T C 3: 62,484,273 I551V probably damaging Het
Dlg5 T A 14: 24,156,469 probably benign Het
Dlgap1 A T 17: 70,761,311 I300F probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah6 T A 6: 73,084,721 R2794* probably null Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgl1 G T 8: 41,197,350 F187L probably benign Het
Fras1 T A 5: 96,712,383 V2096E probably benign Het
Gm10647 A G 9: 66,798,480 probably benign Het
Gm14226 G A 2: 155,024,335 D71N possibly damaging Het
Grip2 A T 6: 91,783,848 I284N probably damaging Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itgal A G 7: 127,330,145 D1078G probably damaging Het
Khdc3 T C 9: 73,103,237 V123A possibly damaging Het
Klhl13 A G X: 23,261,581 probably benign Het
Klhl42 T C 6: 147,091,823 S98P probably damaging Het
Lrp5 T C 19: 3,620,298 N602S possibly damaging Het
Lrrd1 A T 5: 3,851,488 I598F probably damaging Het
Ltbp1 A G 17: 75,151,377 T318A probably benign Het
Mfsd6 A G 1: 52,709,358 F116S probably damaging Het
Ncam1 T C 9: 49,545,192 I486V probably benign Het
Nptx1 A G 11: 119,543,180 probably null Het
Nrg1 T C 8: 31,918,193 Y4C probably damaging Het
Nsf G A 11: 103,882,876 R271* probably null Het
Olfr1049 G C 2: 86,255,096 T199S probably benign Het
Olfr1053 T A 2: 86,315,160 N42I probably damaging Het
Olfr1058 A T 2: 86,385,511 H302Q probably benign Het
Olfr1167 A G 2: 88,149,297 S241P possibly damaging Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pdia4 A G 6: 47,803,879 Y212H probably damaging Het
Pitpnm3 G T 11: 72,074,624 H112N possibly damaging Het
Ppargc1b G T 18: 61,298,777 T1000K possibly damaging Het
Psd3 C A 8: 67,963,487 C586F probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rabep2 A T 7: 126,438,564 R169S possibly damaging Het
Rad21l T C 2: 151,655,259 R309G probably benign Het
Rbm12 T C 2: 156,097,213 R380G probably damaging Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc12a2 A G 18: 57,879,395 T197A possibly damaging Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Sptbn4 T C 7: 27,366,443 E2026G possibly damaging Het
Srf A T 17: 46,551,707 M285K possibly damaging Het
Tanc1 T C 2: 59,791,812 V425A possibly damaging Het
Tle4 A T 19: 14,516,357 probably null Het
Tmem132e A G 11: 82,445,082 R905G possibly damaging Het
Tmem200c A T 17: 68,840,988 I189F probably damaging Het
Trappc13 T C 13: 104,174,642 Q87R probably benign Het
Trpm7 A T 2: 126,831,299 D511E probably damaging Het
Ttc30b A G 2: 75,937,242 L389P probably damaging Het
Ttn A T 2: 76,802,290 I14140N possibly damaging Het
Virma A G 4: 11,513,907 D587G probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r68 A G 7: 85,233,894 F217L probably damaging Het
Vps13c T C 9: 67,973,759 probably null Het
Vrtn T C 12: 84,649,199 V241A probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Pgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pgr APN 9 8903691 missense possibly damaging 0.71
IGL01772:Pgr APN 9 8946636 splice site probably benign
IGL01963:Pgr APN 9 8922668 missense probably damaging 0.97
IGL02033:Pgr APN 9 8965110 missense probably damaging 1.00
IGL02837:Pgr APN 9 8946638 splice site probably benign
IGL03070:Pgr APN 9 8903664 missense possibly damaging 0.86
IGL03300:Pgr APN 9 8961539 missense probably damaging 1.00
R0152:Pgr UTSW 9 8965022 missense probably benign 0.45
R0305:Pgr UTSW 9 8902087 splice site probably benign
R0317:Pgr UTSW 9 8965022 missense probably benign 0.45
R0467:Pgr UTSW 9 8900778 missense possibly damaging 0.92
R1673:Pgr UTSW 9 8902068 missense possibly damaging 0.71
R1711:Pgr UTSW 9 8922714 splice site probably null
R1928:Pgr UTSW 9 8903629 nonsense probably null
R2023:Pgr UTSW 9 8958398 missense probably damaging 0.99
R2426:Pgr UTSW 9 8900717 missense probably damaging 0.98
R2967:Pgr UTSW 9 8901818 missense possibly damaging 0.86
R3105:Pgr UTSW 9 8958396 missense probably benign 0.02
R3440:Pgr UTSW 9 8922629 missense probably damaging 0.98
R3735:Pgr UTSW 9 8901533 missense probably damaging 0.99
R3947:Pgr UTSW 9 8961452 missense probably benign 0.25
R4398:Pgr UTSW 9 8903749 critical splice donor site probably null
R4497:Pgr UTSW 9 8958419 missense probably damaging 0.99
R4811:Pgr UTSW 9 8900843 nonsense probably null
R4907:Pgr UTSW 9 8947043 intron probably benign
R4996:Pgr UTSW 9 8900913 missense probably damaging 0.99
R5448:Pgr UTSW 9 8922637 missense probably benign 0.06
R5449:Pgr UTSW 9 8956343 missense possibly damaging 0.95
R5699:Pgr UTSW 9 8900599 start gained probably benign
R5764:Pgr UTSW 9 8900537 missense probably benign 0.00
R6057:Pgr UTSW 9 8902005 missense probably damaging 0.98
R6134:Pgr UTSW 9 8900739 missense possibly damaging 0.51
R6242:Pgr UTSW 9 8900979 missense probably benign
R6476:Pgr UTSW 9 8964838 intron probably null
R6508:Pgr UTSW 9 8956289 missense probably damaging 1.00
R6604:Pgr UTSW 9 8946866 missense possibly damaging 0.73
R6715:Pgr UTSW 9 8964999 missense possibly damaging 0.93
R7444:Pgr UTSW 9 8946882 missense probably damaging 1.00
X0066:Pgr UTSW 9 8900834 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCAGAGAATCACCTTTTCAC -3'
(R):5'- GATCCAAGGGCTGATGCATG -3'

Sequencing Primer
(F):5'- TCAAGAAATTCAACTGGTCCCG -3'
(R):5'- GCTGATGCATGCTGACCTAG -3'
Posted On2014-08-01