Incidental Mutation 'R1951:Ncam1'
ID217311
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission 039965-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R1951 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49545192 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 486 (I486V)
Ref Sequence ENSEMBL: ENSMUSP00000141700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000192584] [ENSMUST00000193547]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068730
Predicted Effect probably benign
Transcript: ENSMUST00000114476
AA Change: I486V

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542
AA Change: I486V

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166811
AA Change: I486V
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542
AA Change: I486V

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192584
AA Change: I486V

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141700
Gene: ENSMUSG00000039542
AA Change: I486V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 1.2e-6 SMART
IGc2 130 196 2.6e-8 SMART
IGc2 226 295 2.6e-22 SMART
IGc2 321 393 1.6e-16 SMART
IGc2 418 487 4e-13 SMART
FN3 501 586 2.4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193547
AA Change: I486V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542
AA Change: I486V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194252
AA Change: I453V
Predicted Effect probably benign
Transcript: ENSMUST00000194844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216483
Meta Mutation Damage Score 0.2124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Adcy3 T C 12: 4,208,624 F847S probably benign Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Arhgap28 G A 17: 67,901,341 A44V probably benign Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Baz1b T A 5: 135,216,739 N347K probably benign Het
Best2 T A 8: 85,011,229 N179I possibly damaging Het
Bfar C T 16: 13,702,106 S276L probably damaging Het
Bloc1s3 A G 7: 19,507,558 V15A possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Calhm3 A G 19: 47,151,817 L279P probably benign Het
Cand1 A T 10: 119,208,020 probably benign Het
Car15 T C 16: 17,837,405 D57G possibly damaging Het
Casp12 G A 9: 5,348,959 probably null Het
Cd93 T C 2: 148,441,858 T523A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckap5 A G 2: 91,556,492 probably benign Het
Col6a5 G A 9: 105,936,957 R619W unknown Het
Colec12 G A 18: 9,859,975 probably null Het
Crmp1 G A 5: 37,273,355 V222I possibly damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Ctbp2 A G 7: 133,015,027 S60P probably benign Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dhx36 T C 3: 62,484,273 I551V probably damaging Het
Dlg5 T A 14: 24,156,469 probably benign Het
Dlgap1 A T 17: 70,761,311 I300F probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah6 T A 6: 73,084,721 R2794* probably null Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgl1 G T 8: 41,197,350 F187L probably benign Het
Fras1 T A 5: 96,712,383 V2096E probably benign Het
Gm10647 A G 9: 66,798,480 probably benign Het
Gm14226 G A 2: 155,024,335 D71N possibly damaging Het
Grip2 A T 6: 91,783,848 I284N probably damaging Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itgal A G 7: 127,330,145 D1078G probably damaging Het
Khdc3 T C 9: 73,103,237 V123A possibly damaging Het
Klhl13 A G X: 23,261,581 probably benign Het
Klhl42 T C 6: 147,091,823 S98P probably damaging Het
Lrp5 T C 19: 3,620,298 N602S possibly damaging Het
Lrrd1 A T 5: 3,851,488 I598F probably damaging Het
Ltbp1 A G 17: 75,151,377 T318A probably benign Het
Mfsd6 A G 1: 52,709,358 F116S probably damaging Het
Nptx1 A G 11: 119,543,180 probably null Het
Nrg1 T C 8: 31,918,193 Y4C probably damaging Het
Nsf G A 11: 103,882,876 R271* probably null Het
Olfr1049 G C 2: 86,255,096 T199S probably benign Het
Olfr1053 T A 2: 86,315,160 N42I probably damaging Het
Olfr1058 A T 2: 86,385,511 H302Q probably benign Het
Olfr1167 A G 2: 88,149,297 S241P possibly damaging Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pdia4 A G 6: 47,803,879 Y212H probably damaging Het
Pgr A G 9: 8,946,953 probably benign Het
Pitpnm3 G T 11: 72,074,624 H112N possibly damaging Het
Ppargc1b G T 18: 61,298,777 T1000K possibly damaging Het
Psd3 C A 8: 67,963,487 C586F probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rabep2 A T 7: 126,438,564 R169S possibly damaging Het
Rad21l T C 2: 151,655,259 R309G probably benign Het
Rbm12 T C 2: 156,097,213 R380G probably damaging Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc12a2 A G 18: 57,879,395 T197A possibly damaging Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Sptbn4 T C 7: 27,366,443 E2026G possibly damaging Het
Srf A T 17: 46,551,707 M285K possibly damaging Het
Tanc1 T C 2: 59,791,812 V425A possibly damaging Het
Tle4 A T 19: 14,516,357 probably null Het
Tmem132e A G 11: 82,445,082 R905G possibly damaging Het
Tmem200c A T 17: 68,840,988 I189F probably damaging Het
Trappc13 T C 13: 104,174,642 Q87R probably benign Het
Trpm7 A T 2: 126,831,299 D511E probably damaging Het
Ttc30b A G 2: 75,937,242 L389P probably damaging Het
Ttn A T 2: 76,802,290 I14140N possibly damaging Het
Virma A G 4: 11,513,907 D587G probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r68 A G 7: 85,233,894 F217L probably damaging Het
Vps13c T C 9: 67,973,759 probably null Het
Vrtn T C 12: 84,649,199 V241A probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
R7561:Ncam1 UTSW 9 49564942 missense probably damaging 1.00
R7645:Ncam1 UTSW 9 49565003 missense probably benign 0.01
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGACTCCACTTTCGTAGC -3'
(R):5'- ACACTGAGCTCCTTCCACTG -3'

Sequencing Primer
(F):5'- GATGGATTCTCTCTCACTCTAAGTTG -3'
(R):5'- ACTGAGCTCCTTCCACTGAGATAG -3'
Posted On2014-08-01