Incidental Mutation 'R1951:Klhl13'
ID217345
Institutional Source Beutler Lab
Gene Symbol Klhl13
Ensembl Gene ENSMUSG00000036782
Gene Namekelch-like 13
SynonymsD130072F20Rik, Bklhd2, 1200009K10Rik
MMRRC Submission 039965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1951 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location23219271-23365082 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 23261581 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035973] [ENSMUST00000115313] [ENSMUST00000115316] [ENSMUST00000115317] [ENSMUST00000115319]
Predicted Effect probably benign
Transcript: ENSMUST00000035973
SMART Domains Protein: ENSMUSP00000041190
Gene: ENSMUSG00000036782

DomainStartEndE-ValueType
BTB 75 174 6.43e-19 SMART
BACK 179 280 5.87e-26 SMART
Kelch 324 372 4.58e-3 SMART
Kelch 373 424 1.38e-6 SMART
Kelch 425 471 6.71e-10 SMART
Kelch 472 518 3.68e-7 SMART
Kelch 519 570 1.69e-6 SMART
Kelch 571 619 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115313
SMART Domains Protein: ENSMUSP00000110968
Gene: ENSMUSG00000036782

DomainStartEndE-ValueType
BTB 41 140 6.43e-19 SMART
BACK 145 246 5.87e-26 SMART
Kelch 290 338 4.58e-3 SMART
Kelch 339 390 1.38e-6 SMART
Kelch 391 437 6.71e-10 SMART
Kelch 438 484 3.68e-7 SMART
Kelch 485 536 1.69e-6 SMART
Kelch 537 585 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115316
SMART Domains Protein: ENSMUSP00000110971
Gene: ENSMUSG00000036782

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
BTB 77 176 6.43e-19 SMART
BACK 181 282 5.87e-26 SMART
Kelch 326 374 4.58e-3 SMART
Kelch 375 426 1.38e-6 SMART
Kelch 427 473 6.71e-10 SMART
Kelch 474 520 3.68e-7 SMART
Kelch 521 572 1.69e-6 SMART
Kelch 573 621 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115317
SMART Domains Protein: ENSMUSP00000110972
Gene: ENSMUSG00000036782

DomainStartEndE-ValueType
BTB 91 190 6.43e-19 SMART
BACK 195 296 5.87e-26 SMART
Kelch 340 388 4.58e-3 SMART
Kelch 389 440 1.38e-6 SMART
Kelch 441 487 6.71e-10 SMART
Kelch 488 534 3.68e-7 SMART
Kelch 535 586 1.69e-6 SMART
Kelch 587 635 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115319
SMART Domains Protein: ENSMUSP00000110974
Gene: ENSMUSG00000036782

DomainStartEndE-ValueType
BTB 85 184 6.43e-19 SMART
BACK 189 290 5.87e-26 SMART
Kelch 334 382 4.58e-3 SMART
Kelch 383 434 1.38e-6 SMART
Kelch 435 481 6.71e-10 SMART
Kelch 482 528 3.68e-7 SMART
Kelch 529 580 1.69e-6 SMART
Kelch 581 629 1.25e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153345
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a BTB and kelch domain containing protein and belongs to the kelch repeat domain containing superfamily of proteins. The encoded protein functions as an adaptor protein that complexes with Cullin 3 and other proteins to form the Cullin 3-based E3 ubiquitin-protein ligase complex. This complex is necessary for proper chromosome segregation and completion of cytokinesis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Adcy3 T C 12: 4,208,624 F847S probably benign Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Arhgap28 G A 17: 67,901,341 A44V probably benign Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Baz1b T A 5: 135,216,739 N347K probably benign Het
Best2 T A 8: 85,011,229 N179I possibly damaging Het
Bfar C T 16: 13,702,106 S276L probably damaging Het
Bloc1s3 A G 7: 19,507,558 V15A possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Calhm3 A G 19: 47,151,817 L279P probably benign Het
Cand1 A T 10: 119,208,020 probably benign Het
Car15 T C 16: 17,837,405 D57G possibly damaging Het
Casp12 G A 9: 5,348,959 probably null Het
Cd93 T C 2: 148,441,858 T523A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckap5 A G 2: 91,556,492 probably benign Het
Col6a5 G A 9: 105,936,957 R619W unknown Het
Colec12 G A 18: 9,859,975 probably null Het
Crmp1 G A 5: 37,273,355 V222I possibly damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Ctbp2 A G 7: 133,015,027 S60P probably benign Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dhx36 T C 3: 62,484,273 I551V probably damaging Het
Dlg5 T A 14: 24,156,469 probably benign Het
Dlgap1 A T 17: 70,761,311 I300F probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah6 T A 6: 73,084,721 R2794* probably null Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgl1 G T 8: 41,197,350 F187L probably benign Het
Fras1 T A 5: 96,712,383 V2096E probably benign Het
Gm10647 A G 9: 66,798,480 probably benign Het
Gm14226 G A 2: 155,024,335 D71N possibly damaging Het
Grip2 A T 6: 91,783,848 I284N probably damaging Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itgal A G 7: 127,330,145 D1078G probably damaging Het
Khdc3 T C 9: 73,103,237 V123A possibly damaging Het
Klhl42 T C 6: 147,091,823 S98P probably damaging Het
Lrp5 T C 19: 3,620,298 N602S possibly damaging Het
Lrrd1 A T 5: 3,851,488 I598F probably damaging Het
Ltbp1 A G 17: 75,151,377 T318A probably benign Het
Mfsd6 A G 1: 52,709,358 F116S probably damaging Het
Ncam1 T C 9: 49,545,192 I486V probably benign Het
Nptx1 A G 11: 119,543,180 probably null Het
Nrg1 T C 8: 31,918,193 Y4C probably damaging Het
Nsf G A 11: 103,882,876 R271* probably null Het
Olfr1049 G C 2: 86,255,096 T199S probably benign Het
Olfr1053 T A 2: 86,315,160 N42I probably damaging Het
Olfr1058 A T 2: 86,385,511 H302Q probably benign Het
Olfr1167 A G 2: 88,149,297 S241P possibly damaging Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pdia4 A G 6: 47,803,879 Y212H probably damaging Het
Pgr A G 9: 8,946,953 probably benign Het
Pitpnm3 G T 11: 72,074,624 H112N possibly damaging Het
Ppargc1b G T 18: 61,298,777 T1000K possibly damaging Het
Psd3 C A 8: 67,963,487 C586F probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rabep2 A T 7: 126,438,564 R169S possibly damaging Het
Rad21l T C 2: 151,655,259 R309G probably benign Het
Rbm12 T C 2: 156,097,213 R380G probably damaging Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc12a2 A G 18: 57,879,395 T197A possibly damaging Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Sptbn4 T C 7: 27,366,443 E2026G possibly damaging Het
Srf A T 17: 46,551,707 M285K possibly damaging Het
Tanc1 T C 2: 59,791,812 V425A possibly damaging Het
Tle4 A T 19: 14,516,357 probably null Het
Tmem132e A G 11: 82,445,082 R905G possibly damaging Het
Tmem200c A T 17: 68,840,988 I189F probably damaging Het
Trappc13 T C 13: 104,174,642 Q87R probably benign Het
Trpm7 A T 2: 126,831,299 D511E probably damaging Het
Ttc30b A G 2: 75,937,242 L389P probably damaging Het
Ttn A T 2: 76,802,290 I14140N possibly damaging Het
Virma A G 4: 11,513,907 D587G probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r68 A G 7: 85,233,894 F217L probably damaging Het
Vps13c T C 9: 67,973,759 probably null Het
Vrtn T C 12: 84,649,199 V241A probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Klhl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3698:Klhl13 UTSW X 23248183 missense probably benign 0.06
R3873:Klhl13 UTSW X 23285176 missense probably benign 0.06
R3874:Klhl13 UTSW X 23285176 missense probably benign 0.06
R4241:Klhl13 UTSW X 23315175 missense probably damaging 0.99
R4242:Klhl13 UTSW X 23315175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCAAAAGAGCAGTCAAGATTAC -3'
(R):5'- TAAAAGTTGCTTGAGGCTGCAG -3'

Sequencing Primer
(F):5'- AGAGCAGTCAAGATTACCTGTAAC -3'
(R):5'- GCTTGAGGCTGCAGCTTAAAACTC -3'
Posted On2014-08-01