Incidental Mutation 'R0133:Odf2l'
Institutional Source Beutler Lab
Gene Symbol Odf2l
Ensembl Gene ENSMUSG00000028256
Gene Nameouter dense fiber of sperm tails 2-like
Synonyms9630045K08Rik, 4733401D09Rik
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R0133 (G1)
Quality Score38
Status Validated (trace)
Chromosomal Location145118588-145153915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145148541 bp
Amino Acid Change Asparagine to Serine at position 383 (N383S)
Ref Sequence ENSEMBL: ENSMUSP00000029920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029920] [ENSMUST00000098538] [ENSMUST00000098539] [ENSMUST00000106192] [ENSMUST00000200353]
Predicted Effect probably damaging
Transcript: ENSMUST00000029920
AA Change: N383S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029920
Gene: ENSMUSG00000028256
AA Change: N383S

coiled coil region 31 58 N/A INTRINSIC
coiled coil region 85 183 N/A INTRINSIC
coiled coil region 206 367 N/A INTRINSIC
coiled coil region 388 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098538
AA Change: N479S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096140
Gene: ENSMUSG00000028256
AA Change: N479S

coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098539
AA Change: N426S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096141
Gene: ENSMUSG00000028256
AA Change: N426S

coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106192
AA Change: N426S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101798
Gene: ENSMUSG00000028256
AA Change: N426S

coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195926
AA Change: N91S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196426
Predicted Effect probably benign
Transcript: ENSMUST00000198764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200014
Predicted Effect probably benign
Transcript: ENSMUST00000200353
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Odf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Odf2l APN 3 145127873 missense possibly damaging 0.93
IGL00821:Odf2l APN 3 145150987 missense probably damaging 1.00
IGL01984:Odf2l APN 3 145139829 nonsense probably null
R0080:Odf2l UTSW 3 145124323 missense possibly damaging 0.63
R0436:Odf2l UTSW 3 145126116 missense possibly damaging 0.91
R1218:Odf2l UTSW 3 145148932 missense probably damaging 1.00
R1521:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R1677:Odf2l UTSW 3 145139782 critical splice acceptor site probably null
R1884:Odf2l UTSW 3 145151048 missense probably damaging 1.00
R2151:Odf2l UTSW 3 145149024 missense possibly damaging 0.86
R2910:Odf2l UTSW 3 145124323 missense probably benign 0.00
R2911:Odf2l UTSW 3 145124323 missense probably benign 0.00
R4552:Odf2l UTSW 3 145151083 missense probably benign 0.02
R4640:Odf2l UTSW 3 145128945 missense probably damaging 1.00
R4667:Odf2l UTSW 3 145128040 missense probably benign 0.04
R5472:Odf2l UTSW 3 145146866 missense probably benign 0.00
R5769:Odf2l UTSW 3 145135731 missense possibly damaging 0.91
R5877:Odf2l UTSW 3 145129010 unclassified probably null
R6026:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6351:Odf2l UTSW 3 145135718 missense probably benign 0.11
R6454:Odf2l UTSW 3 145153420 missense possibly damaging 0.93
R6462:Odf2l UTSW 3 145146911 missense probably damaging 1.00
R6888:Odf2l UTSW 3 145148618 critical splice donor site probably null
R7008:Odf2l UTSW 3 145132734 missense probably damaging 1.00
R7121:Odf2l UTSW 3 145139820 missense possibly damaging 0.93
R7151:Odf2l UTSW 3 145127066 missense probably benign 0.26
R7542:Odf2l UTSW 3 145153436 missense probably damaging 0.99
R7664:Odf2l UTSW 3 145148584 missense probably benign 0.41
R7811:Odf2l UTSW 3 145153387 missense probably benign 0.00
R7816:Odf2l UTSW 3 145151015 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acatacacacatagacatatacacac -3'
Posted On2013-04-12