Incidental Mutation 'R1952:Rapgef4'
ID217353
Institutional Source Beutler Lab
Gene Symbol Rapgef4
Ensembl Gene ENSMUSG00000049044
Gene NameRap guanine nucleotide exchange factor (GEF) 4
SynonymscAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
MMRRC Submission 039966-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R1952 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71981240-72257474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72208127 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 541 (M541V)
Ref Sequence ENSEMBL: ENSMUSP00000088336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028525] [ENSMUST00000090826] [ENSMUST00000102698]
PDB Structure
CRYSTAL STRUCTURE OF THE REGULATORY DOMAIN OF EPAC2 [X-RAY DIFFRACTION]
STRUCTURE OF THE CAMP RESPONSIVE EXCHANGE FACTOR EPAC2 IN ITS AUTO-INHIBITED STATE [X-RAY DIFFRACTION]
Structure of Epac2 in complex with cyclic-AMP and Rap [X-RAY DIFFRACTION]
Conformational dynamics of exchange protein directly activated by cAMP [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028525
AA Change: M397V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028525
Gene: ENSMUSG00000049044
AA Change: M397V

DomainStartEndE-ValueType
DEP 72 147 3.43e-27 SMART
low complexity region 158 167 N/A INTRINSIC
cNMP 212 331 4.02e-15 SMART
RasGEFN 351 486 3.61e-7 SMART
Blast:RasGEF 534 607 1e-33 BLAST
RasGEF 624 866 8.09e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090826
AA Change: M541V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: M541V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 216 291 3.43e-27 SMART
low complexity region 302 311 N/A INTRINSIC
cNMP 356 475 4.02e-15 SMART
RasGEFN 495 630 3.61e-7 SMART
Blast:RasGEF 678 751 2e-33 BLAST
RasGEF 768 1010 8.09e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102698
AA Change: M523V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: M523V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 198 273 3.43e-27 SMART
low complexity region 284 293 N/A INTRINSIC
cNMP 338 457 4.02e-15 SMART
RasGEFN 477 612 3.61e-7 SMART
Blast:RasGEF 660 733 2e-33 BLAST
RasGEF 750 992 8.09e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156031
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Cers4 G A 8: 4,523,461 W319* probably null Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Hap1 A G 11: 100,352,279 V174A probably damaging Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nin T A 12: 70,030,926 Q1035L probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Olfr970 T C 9: 39,820,067 S143P probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rhbdf1 G A 11: 32,214,277 R234* probably null Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Sytl3 A C 17: 6,728,333 T171P probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Rapgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rapgef4 APN 2 72256312 missense possibly damaging 0.75
IGL00858:Rapgef4 APN 2 72198897 missense probably damaging 1.00
IGL01408:Rapgef4 APN 2 72174841 nonsense probably null
IGL01673:Rapgef4 APN 2 72241437 missense probably damaging 0.99
IGL01678:Rapgef4 APN 2 72242225 splice site probably benign
IGL01725:Rapgef4 APN 2 72174874 missense probably benign 0.24
IGL01871:Rapgef4 APN 2 72198360 missense possibly damaging 0.69
IGL01935:Rapgef4 APN 2 72234123 missense probably benign 0.05
IGL02001:Rapgef4 APN 2 72225052 splice site probably benign
IGL02041:Rapgef4 APN 2 72198796 missense probably damaging 1.00
IGL02134:Rapgef4 APN 2 72180061 missense probably damaging 0.97
IGL02410:Rapgef4 APN 2 72226594 missense possibly damaging 0.51
IGL02807:Rapgef4 APN 2 72205649 splice site probably benign
IGL03066:Rapgef4 APN 2 72141179 splice site probably benign
IGL03282:Rapgef4 APN 2 72205752 splice site probably benign
IGL03291:Rapgef4 APN 2 72195703 missense probably damaging 1.00
P0033:Rapgef4 UTSW 2 72137331 intron probably benign
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0309:Rapgef4 UTSW 2 72226030 missense probably benign 0.02
R0398:Rapgef4 UTSW 2 72031041 missense probably damaging 0.99
R0747:Rapgef4 UTSW 2 72223073 missense possibly damaging 0.66
R1216:Rapgef4 UTSW 2 72208148 missense possibly damaging 0.51
R1264:Rapgef4 UTSW 2 72031105 missense possibly damaging 0.48
R1302:Rapgef4 UTSW 2 72045160 missense probably benign 0.31
R1460:Rapgef4 UTSW 2 72031176 critical splice donor site probably null
R1483:Rapgef4 UTSW 2 72055026 critical splice donor site probably null
R1682:Rapgef4 UTSW 2 72226568 missense possibly damaging 0.80
R1768:Rapgef4 UTSW 2 72225787 splice site probably benign
R1858:Rapgef4 UTSW 2 72031064 missense possibly damaging 0.67
R1860:Rapgef4 UTSW 2 72234720 missense probably benign 0.05
R2025:Rapgef4 UTSW 2 72242739 missense probably benign 0.01
R2128:Rapgef4 UTSW 2 72226553 missense possibly damaging 0.87
R2159:Rapgef4 UTSW 2 72174881 missense probably damaging 1.00
R2201:Rapgef4 UTSW 2 72045189 missense probably damaging 0.96
R2883:Rapgef4 UTSW 2 72031125 missense probably benign
R3015:Rapgef4 UTSW 2 72198373 missense probably damaging 1.00
R4278:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R5256:Rapgef4 UTSW 2 72034034 missense probably damaging 0.97
R5572:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5574:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5575:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5749:Rapgef4 UTSW 2 72242757 missense probably damaging 1.00
R6007:Rapgef4 UTSW 2 72179949 missense possibly damaging 0.55
R6084:Rapgef4 UTSW 2 72196278 critical splice donor site probably null
R6192:Rapgef4 UTSW 2 71981317 missense probably benign 0.00
R6409:Rapgef4 UTSW 2 72178237 missense probably benign 0.01
R6683:Rapgef4 UTSW 2 72054779 intron probably benign
R6774:Rapgef4 UTSW 2 72225775 missense probably benign 0.01
R6844:Rapgef4 UTSW 2 72234626 missense probably damaging 0.99
R6999:Rapgef4 UTSW 2 72239125 missense probably damaging 1.00
R7077:Rapgef4 UTSW 2 72241476 missense probably damaging 0.96
R7138:Rapgef4 UTSW 2 72198363 missense probably damaging 1.00
R7275:Rapgef4 UTSW 2 72208101 missense probably damaging 1.00
R7352:Rapgef4 UTSW 2 72180091 missense probably damaging 1.00
R7397:Rapgef4 UTSW 2 72205666 missense probably benign 0.23
R7508:Rapgef4 UTSW 2 72205733 missense probably benign 0.00
R7620:Rapgef4 UTSW 2 72229078 missense probably damaging 0.99
R7703:Rapgef4 UTSW 2 72179971 missense probably benign 0.28
X0062:Rapgef4 UTSW 2 72226607 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGTTCCATCCATACAAGGCTG -3'
(R):5'- GGCGCTTCAGAGTCTGATAAG -3'

Sequencing Primer
(F):5'- CCATACAAGGCTGTCTTCCTATATG -3'
(R):5'- TTCAGAGTCTGATAAGACCAAAAGC -3'
Posted On2014-08-01