Incidental Mutation 'R1952:Nlgn1'
ID217359
Institutional Source Beutler Lab
Gene Symbol Nlgn1
Ensembl Gene ENSMUSG00000063887
Gene Nameneuroligin 1
SynonymsNL1, Nlg1, 6330415N05Rik
MMRRC Submission 039966-MU
Accession Numbers

Ncbi RefSeq: NM_138666.3; NM_001163387.1; MGI:2179435

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1952 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location25426215-26332460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25436300 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 421 (D421V)
Ref Sequence ENSEMBL: ENSMUSP00000142200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075054] [ENSMUST00000108308] [ENSMUST00000191835] [ENSMUST00000193603]
PDB Structure
Crystal structure of a synaptic adhesion complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075054
AA Change: D421V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074565
Gene: ENSMUSG00000063887
AA Change: D421V

DomainStartEndE-ValueType
Pfam:COesterase 29 626 4.8e-199 PFAM
Pfam:Abhydrolase_3 196 302 2.2e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108308
AA Change: D392V

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103944
Gene: ENSMUSG00000063887
AA Change: D392V

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191835
AA Change: D392V

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142086
Gene: ENSMUSG00000063887
AA Change: D392V

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193603
AA Change: D421V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142200
Gene: ENSMUSG00000063887
AA Change: D421V

DomainStartEndE-ValueType
Pfam:COesterase 29 626 1.2e-186 PFAM
Pfam:Abhydrolase_3 196 309 3.7e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype Strain: 3687638
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but display impaired NMDA receptor-mediated synaptic transmission onto CA1 pyramidal cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Cers4 G A 8: 4,523,461 W319* probably null Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Hap1 A G 11: 100,352,279 V174A probably damaging Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nin T A 12: 70,030,926 Q1035L probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Olfr970 T C 9: 39,820,067 S143P probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rapgef4 A G 2: 72,208,127 M541V probably benign Het
Rhbdf1 G A 11: 32,214,277 R234* probably null Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Sytl3 A C 17: 6,728,333 T171P probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Nlgn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Nlgn1 APN 3 25436490 missense probably benign 0.02
IGL00543:Nlgn1 APN 3 25433781 missense probably damaging 1.00
IGL00960:Nlgn1 APN 3 25912697 missense probably damaging 1.00
IGL01533:Nlgn1 APN 3 25436363 missense possibly damaging 0.69
IGL02146:Nlgn1 APN 3 25912682 missense probably damaging 0.96
IGL02616:Nlgn1 APN 3 25434245 missense probably damaging 0.99
IGL03342:Nlgn1 APN 3 26133262 missense probably damaging 1.00
P0018:Nlgn1 UTSW 3 25436577 missense probably damaging 1.00
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0123:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0134:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0294:Nlgn1 UTSW 3 26133476 missense probably benign 0.23
R0798:Nlgn1 UTSW 3 25434246 missense probably benign 0.05
R1051:Nlgn1 UTSW 3 25912705 missense probably damaging 0.98
R1116:Nlgn1 UTSW 3 25433874 missense probably benign 0.00
R1289:Nlgn1 UTSW 3 25434236 missense possibly damaging 0.87
R1522:Nlgn1 UTSW 3 25435909 missense probably damaging 1.00
R1550:Nlgn1 UTSW 3 25912644 missense probably damaging 1.00
R1669:Nlgn1 UTSW 3 25436134 missense probably damaging 1.00
R1853:Nlgn1 UTSW 3 26133522 missense possibly damaging 0.80
R1856:Nlgn1 UTSW 3 25440037 nonsense probably null
R1935:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1936:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1953:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R2004:Nlgn1 UTSW 3 25433870 missense probably benign 0.29
R2114:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2116:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2198:Nlgn1 UTSW 3 25433761 missense probably damaging 0.99
R2994:Nlgn1 UTSW 3 25435998 missense probably damaging 1.00
R3056:Nlgn1 UTSW 3 25433696 missense possibly damaging 0.53
R4190:Nlgn1 UTSW 3 25433898 missense probably benign
R4196:Nlgn1 UTSW 3 25434392 missense probably damaging 1.00
R4613:Nlgn1 UTSW 3 25436022 missense probably benign 0.01
R4654:Nlgn1 UTSW 3 26133701 missense possibly damaging 0.51
R4757:Nlgn1 UTSW 3 25436168 missense probably damaging 1.00
R4757:Nlgn1 UTSW 3 25436343 missense possibly damaging 0.63
R4815:Nlgn1 UTSW 3 25436030 missense probably damaging 0.99
R4884:Nlgn1 UTSW 3 25912674 missense probably damaging 1.00
R4966:Nlgn1 UTSW 3 25920237 missense possibly damaging 0.65
R5119:Nlgn1 UTSW 3 25433794 missense probably damaging 0.99
R5842:Nlgn1 UTSW 3 26133743 unclassified probably null
R6218:Nlgn1 UTSW 3 25436093 missense probably damaging 1.00
R6397:Nlgn1 UTSW 3 25433663 missense possibly damaging 0.53
R6500:Nlgn1 UTSW 3 25433930 missense possibly damaging 0.84
R6822:Nlgn1 UTSW 3 26133647 missense probably benign 0.00
R6846:Nlgn1 UTSW 3 25436342 missense probably damaging 0.99
R7047:Nlgn1 UTSW 3 25436035 nonsense probably null
R7147:Nlgn1 UTSW 3 26133360 missense probably benign 0.02
R7754:Nlgn1 UTSW 3 25434303 missense probably damaging 1.00
R7886:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
R7969:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCCATTGATGGTCCGTAAAC -3'
(R):5'- TGCCTGCAGAAGAAGCCTTAC -3'

Sequencing Primer
(F):5'- TTGATGGTCCGTAAACAAAGCC -3'
(R):5'- GAAGCCTTACAAAGAACTTGTTGATC -3'
Posted On2014-08-01