Incidental Mutation 'R1952:Cers4'
ID217381
Institutional Source Beutler Lab
Gene Symbol Cers4
Ensembl Gene ENSMUSG00000008206
Gene Nameceramide synthase 4
SynonymsLass4, CerS4, Trh1, 2900019C14Rik
MMRRC Submission 039966-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1952 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4493026-4531680 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 4523461 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 319 (W319*)
Ref Sequence ENSEMBL: ENSMUSP00000008350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008350] [ENSMUST00000176130]
Predicted Effect probably null
Transcript: ENSMUST00000008350
AA Change: W319*
SMART Domains Protein: ENSMUSP00000008350
Gene: ENSMUSG00000008206
AA Change: W319*

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175781
SMART Domains Protein: ENSMUSP00000138819
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176130
SMART Domains Protein: ENSMUSP00000135652
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
transmembrane domain 39 56 N/A INTRINSIC
HOX 75 132 1.2e-4 SMART
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177010
SMART Domains Protein: ENSMUSP00000135763
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
Blast:TLC 4 58 7e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193830
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered lipid composition of the sebum and hair follicle dystrophy that results in a progressive form of alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Hap1 A G 11: 100,352,279 V174A probably damaging Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nin T A 12: 70,030,926 Q1035L probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Olfr970 T C 9: 39,820,067 S143P probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rapgef4 A G 2: 72,208,127 M541V probably benign Het
Rhbdf1 G A 11: 32,214,277 R234* probably null Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Sytl3 A C 17: 6,728,333 T171P probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Cers4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cers4 APN 8 4521216 missense probably benign 0.13
IGL02407:Cers4 APN 8 4520306 nonsense probably null
IGL03244:Cers4 APN 8 4516878 missense probably damaging 0.99
Radlauer UTSW 8 4519475 missense probably damaging 1.00
willis UTSW 8 4518269 nonsense probably null
R1170:Cers4 UTSW 8 4519475 missense probably damaging 1.00
R1177:Cers4 UTSW 8 4516931 missense probably null 0.00
R1346:Cers4 UTSW 8 4515632 missense probably damaging 1.00
R1506:Cers4 UTSW 8 4520557 missense probably benign 0.30
R1652:Cers4 UTSW 8 4516908 unclassified probably null
R1819:Cers4 UTSW 8 4521232 missense probably benign 0.00
R3790:Cers4 UTSW 8 4518285 missense possibly damaging 0.87
R4342:Cers4 UTSW 8 4521223 missense probably damaging 1.00
R5001:Cers4 UTSW 8 4515565 missense probably benign 0.33
R5338:Cers4 UTSW 8 4515680 missense probably damaging 0.98
R5785:Cers4 UTSW 8 4516992 critical splice donor site probably null
R5980:Cers4 UTSW 8 4518269 nonsense probably null
R6315:Cers4 UTSW 8 4516980 missense probably benign 0.02
R6891:Cers4 UTSW 8 4523731 missense probably damaging 0.99
R7554:Cers4 UTSW 8 4515718 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGAGCACAGAGTCCATTTAC -3'
(R):5'- TTCAGAAACTGGCTCGTCATC -3'

Sequencing Primer
(F):5'- TTACGCTACTTCATGGAATGAGGAGC -3'
(R):5'- AGAAACTGGCTCGTCATCACTGG -3'
Posted On2014-08-01