Incidental Mutation 'R1952:Olfr970'
ID217386
Institutional Source Beutler Lab
Gene Symbol Olfr970
Ensembl Gene ENSMUSG00000095774
Gene Nameolfactory receptor 970
SynonymsMOR171-16, GA_x6K02T2PVTD-33517322-33518257
MMRRC Submission 039966-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R1952 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39808860-39820997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39820067 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000150325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071132] [ENSMUST00000213975] [ENSMUST00000215922]
Predicted Effect probably benign
Transcript: ENSMUST00000071132
AA Change: S143P

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071132
Gene: ENSMUSG00000095774
AA Change: S143P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-53 PFAM
Pfam:7tm_1 41 290 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213975
AA Change: S143P

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215265
Predicted Effect probably benign
Transcript: ENSMUST00000215922
AA Change: S143P

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Cers4 G A 8: 4,523,461 W319* probably null Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Hap1 A G 11: 100,352,279 V174A probably damaging Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nin T A 12: 70,030,926 Q1035L probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rapgef4 A G 2: 72,208,127 M541V probably benign Het
Rhbdf1 G A 11: 32,214,277 R234* probably null Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Sytl3 A C 17: 6,728,333 T171P probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Olfr970
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr970 APN 9 39820002 missense probably damaging 1.00
IGL02674:Olfr970 APN 9 39819638 unclassified probably null
R0659:Olfr970 UTSW 9 39819816 missense possibly damaging 0.78
R0686:Olfr970 UTSW 9 39819668 missense probably damaging 0.98
R2068:Olfr970 UTSW 9 39820550 missense probably benign 0.00
R4472:Olfr970 UTSW 9 39820574 makesense probably null
R4798:Olfr970 UTSW 9 39819897 missense probably benign 0.13
R5035:Olfr970 UTSW 9 39820094 missense possibly damaging 0.82
R5339:Olfr970 UTSW 9 39819933 missense probably damaging 0.97
R6751:Olfr970 UTSW 9 39819897 missense probably benign 0.13
R7211:Olfr970 UTSW 9 39819858 missense possibly damaging 0.76
R7471:Olfr970 UTSW 9 39820127 missense probably benign 0.00
R7609:Olfr970 UTSW 9 39820287 missense probably benign
R7638:Olfr970 UTSW 9 39819893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACAGTGAAGAACATCATCTC -3'
(R):5'- TTTGGACCTGCCTTCAGTGG -3'

Sequencing Primer
(F):5'- GTGAAGAACATCATCTCCTATCCTG -3'
(R):5'- GGACCTGCCTTCAGTGGATTTAATC -3'
Posted On2014-08-01