Incidental Mutation 'R1952:Rhbdf1'
ID217399
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Namerhomboid 5 homolog 1
SynonymsDist, Dist1, Egfr-rs
MMRRC Submission 039966-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R1952 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location32209585-32222300 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 32214277 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 234 (R234*)
Ref Sequence ENSEMBL: ENSMUSP00000020524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000144902] [ENSMUST00000146179] [ENSMUST00000150381]
Predicted Effect probably null
Transcript: ENSMUST00000020524
AA Change: R234*
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: R234*

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143036
Predicted Effect probably benign
Transcript: ENSMUST00000143988
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144902
SMART Domains Protein: ENSMUSP00000122533
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Cers4 G A 8: 4,523,461 W319* probably null Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Hap1 A G 11: 100,352,279 V174A probably damaging Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nin T A 12: 70,030,926 Q1035L probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Olfr970 T C 9: 39,820,067 S143P probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rapgef4 A G 2: 72,208,127 M541V probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Sytl3 A C 17: 6,728,333 T171P probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 unclassified probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 unclassified probably null
R5728:Rhbdf1 UTSW 11 32209901 unclassified probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- TCTGATGGGGACTCAAACACCTC -3'
(R):5'- TCGCAAACGTGAATCGGTGG -3'

Sequencing Primer
(F):5'- AAACACCTCATCTGGGTACGTGG -3'
(R):5'- ATCGGTGGCCAAGATGAGCTTC -3'
Posted On2014-08-01