Incidental Mutation 'R1952:Hap1'
ID217403
Institutional Source Beutler Lab
Gene Symbol Hap1
Ensembl Gene ENSMUSG00000006930
Gene Namehuntingtin-associated protein 1
SynonymsHAP-1
MMRRC Submission 039966-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R1952 (G1)
Quality Score127
Status Not validated
Chromosome11
Chromosomal Location100347327-100356128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100352279 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 174 (V174A)
Ref Sequence ENSEMBL: ENSMUSP00000134625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103124] [ENSMUST00000138603] [ENSMUST00000146878] [ENSMUST00000174635]
Predicted Effect probably damaging
Transcript: ENSMUST00000103124
AA Change: V322A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099413
Gene: ENSMUSG00000006930
AA Change: V322A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 79 403 5e-111 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138603
AA Change: V322A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133356
Gene: ENSMUSG00000006930
AA Change: V322A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 80 402 1.4e-109 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146878
AA Change: V174A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134625
Gene: ENSMUSG00000006930
AA Change: V174A

DomainStartEndE-ValueType
Pfam:HAP1_N 1 181 2.2e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173304
Predicted Effect unknown
Transcript: ENSMUST00000173630
AA Change: V96A
SMART Domains Protein: ENSMUSP00000134050
Gene: ENSMUSG00000006930
AA Change: V96A

DomainStartEndE-ValueType
Pfam:HAP1_N 1 177 1e-46 PFAM
low complexity region 250 268 N/A INTRINSIC
low complexity region 275 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174635
SMART Domains Protein: ENSMUSP00000133831
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
low complexity region 119 137 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene was first identified as a neuronal protein that binds the HD protein huntingtin. The protein also interacts with kinesin light chain, 14-3-3 proteins, and Abelson helper integration site 1 protein. The protein is involved in intracellular trafficking of vesicles and organelles, and lack of the protein results in neuronal death resembling the hypothalamic degeneration that occurs in Huntington's disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal feeding and/or suckling behavior, absent gastric milk in neonates, slow postnatal weight gain, and postnatal death. Degeneration in hypothalamic regions that control feeding behavior has been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Cers4 G A 8: 4,523,461 W319* probably null Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nin T A 12: 70,030,926 Q1035L probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Olfr970 T C 9: 39,820,067 S143P probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rapgef4 A G 2: 72,208,127 M541V probably benign Het
Rhbdf1 G A 11: 32,214,277 R234* probably null Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Sytl3 A C 17: 6,728,333 T171P probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Hap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Hap1 APN 11 100349548 missense probably benign 0.00
IGL01320:Hap1 APN 11 100349380 missense probably damaging 0.96
IGL01790:Hap1 APN 11 100351906 unclassified probably null
IGL01949:Hap1 APN 11 100348762 missense probably damaging 0.96
IGL02325:Hap1 APN 11 100354364 critical splice acceptor site probably null
IGL03399:Hap1 APN 11 100354267 missense possibly damaging 0.90
R0346:Hap1 UTSW 11 100356029 missense probably benign
R0463:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R0608:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R1112:Hap1 UTSW 11 100354317 missense probably damaging 1.00
R1682:Hap1 UTSW 11 100349476 missense possibly damaging 0.46
R2079:Hap1 UTSW 11 100353746 missense probably damaging 1.00
R2088:Hap1 UTSW 11 100356002 missense probably benign
R2112:Hap1 UTSW 11 100353999 missense probably benign 0.28
R2211:Hap1 UTSW 11 100354724 missense probably benign 0.21
R2354:Hap1 UTSW 11 100354715 missense probably damaging 1.00
R3829:Hap1 UTSW 11 100356021 missense probably damaging 0.99
R4259:Hap1 UTSW 11 100351842 critical splice donor site probably null
R4429:Hap1 UTSW 11 100354272 missense probably benign 0.00
R4585:Hap1 UTSW 11 100354724 missense probably benign 0.21
R4586:Hap1 UTSW 11 100354724 missense probably benign 0.21
R5085:Hap1 UTSW 11 100355711 missense probably damaging 1.00
R5133:Hap1 UTSW 11 100351531 missense probably benign 0.00
R5762:Hap1 UTSW 11 100355774 missense probably damaging 1.00
R6118:Hap1 UTSW 11 100355794 missense probably benign 0.24
R6148:Hap1 UTSW 11 100349392 missense probably damaging 1.00
R7221:Hap1 UTSW 11 100348829 missense probably benign 0.02
R7683:Hap1 UTSW 11 100351548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACAGCTCTCCCGTCATC -3'
(R):5'- TGACACTGGCTCCATTGTACC -3'

Sequencing Primer
(F):5'- GTCATCTCTGCCAACTCTGATG -3'
(R):5'- TGGACAAGGGATCAGGTCTTACC -3'
Posted On2014-08-01