Incidental Mutation 'R1952:Nin'
ID217406
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Nameninein
Synonyms3110068G20Rik
MMRRC Submission 039966-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1952 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70011435-70113717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70030926 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1035 (Q1035L)
Ref Sequence ENSEMBL: ENSMUSP00000152530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021468
AA Change: Q1742L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: Q1742L

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085314
AA Change: Q1742L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: Q1742L

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095666
AA Change: Q1742L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: Q1742L

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169074
AA Change: Q1742L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: Q1742L

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220689
AA Change: Q1035L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably benign
Transcript: ENSMUST00000221579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222137
Predicted Effect probably damaging
Transcript: ENSMUST00000222237
AA Change: Q1742L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223048
Predicted Effect possibly damaging
Transcript: ENSMUST00000223257
AA Change: Q1742L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223469
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Cers4 G A 8: 4,523,461 W319* probably null Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Hap1 A G 11: 100,352,279 V174A probably damaging Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Olfr970 T C 9: 39,820,067 S143P probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rapgef4 A G 2: 72,208,127 M541V probably benign Het
Rhbdf1 G A 11: 32,214,277 R234* probably null Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Sytl3 A C 17: 6,728,333 T171P probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- TCCCATGGGATCATTCTGAGGC -3'
(R):5'- AGAGTCAGGAAAGCATCACTCC -3'

Sequencing Primer
(F):5'- ATCATTCTGAGGCTCCTTGAG -3'
(R):5'- TTCTCCTCAAGGCAGATGGG -3'
Posted On2014-08-01