Incidental Mutation 'R1952:Sytl3'
ID217416
Institutional Source Beutler Lab
Gene Symbol Sytl3
Ensembl Gene ENSMUSG00000041831
Gene Namesynaptotagmin-like 3
SynonymsSlp3-b, Slp3-a, Slp3
MMRRC Submission 039966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1952 (G1)
Quality Score143
Status Not validated
Chromosome17
Chromosomal Location6659093-6738044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 6728333 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 171 (T171P)
Ref Sequence ENSEMBL: ENSMUSP00000123996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097430] [ENSMUST00000159394] [ENSMUST00000159880] [ENSMUST00000160483] [ENSMUST00000161118] [ENSMUST00000162635]
Predicted Effect probably damaging
Transcript: ENSMUST00000097430
AA Change: T376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095041
Gene: ENSMUSG00000041831
AA Change: T376P

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 6e-25 PFAM
low complexity region 162 170 N/A INTRINSIC
C2 321 426 9.17e-15 SMART
C2 478 601 1.92e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159394
SMART Domains Protein: ENSMUSP00000124146
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 3.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159880
AA Change: T181P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125469
Gene: ENSMUSG00000041831
AA Change: T181P

DomainStartEndE-ValueType
C2 116 221 9.17e-15 SMART
C2 273 396 1.92e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160483
AA Change: T171P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123996
Gene: ENSMUSG00000041831
AA Change: T171P

DomainStartEndE-ValueType
C2 126 231 9.17e-15 SMART
C2 283 406 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161118
Predicted Effect probably benign
Transcript: ENSMUST00000162635
SMART Domains Protein: ENSMUSP00000124496
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 4.3e-27 PFAM
low complexity region 158 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232362
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. This protein binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A G 14: 32,388,336 V6A possibly damaging Het
Accsl G T 2: 93,859,433 H376Q probably damaging Het
Adgrg1 T C 8: 95,008,491 probably null Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ankrd12 T C 17: 66,031,571 D128G probably damaging Het
Bcl2l14 A G 6: 134,432,366 Y301C probably damaging Het
Camsap3 A G 8: 3,604,789 T804A probably damaging Het
Capn11 A T 17: 45,642,959 W154R probably damaging Het
Cd44 T A 2: 102,853,087 T201S probably damaging Het
Cers4 G A 8: 4,523,461 W319* probably null Het
Col27a1 T A 4: 63,283,893 probably null Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dusp7 T A 9: 106,370,829 C219S probably benign Het
Epha7 A G 4: 28,950,474 N759S probably damaging Het
Fat1 T C 8: 45,033,926 V3413A probably benign Het
Gls2 A G 10: 128,209,362 H576R probably benign Het
Gm4884 G A 7: 41,044,247 V547M probably benign Het
Grasp T C 15: 101,224,500 Y67H probably benign Het
Hap1 A G 11: 100,352,279 V174A probably damaging Het
Il12rb2 A G 6: 67,292,316 S838P probably damaging Het
Ints8 T C 4: 11,221,150 I742V probably benign Het
Katnal2 G T 18: 76,980,011 S411R probably benign Het
Lrp1 A C 10: 127,567,431 V2091G probably damaging Het
Mettl21c A T 1: 44,017,208 D20E probably damaging Het
Mib1 A T 18: 10,812,077 E991D possibly damaging Het
Mip T C 10: 128,225,903 S8P possibly damaging Het
Mllt6 T C 11: 97,677,222 S826P probably damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Myrfl C T 10: 116,822,811 V414I probably benign Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nin T A 12: 70,030,926 Q1035L probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 A G 7: 108,924,563 V570A probably benign Het
Olfm3 A T 3: 115,101,940 E157V probably null Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Olfr970 T C 9: 39,820,067 S143P probably benign Het
Otud7a A G 7: 63,650,876 D21G probably damaging Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pcf11 A T 7: 92,661,338 S481T probably damaging Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Prl3a1 G A 13: 27,270,153 G38E possibly damaging Het
Psmb8 T C 17: 34,200,910 V246A probably damaging Het
Ptpn12 A T 5: 20,998,310 V490E probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Qars G A 9: 108,513,181 R427H probably benign Het
R3hdml T C 2: 163,498,296 F128L probably benign Het
Rapgef4 A G 2: 72,208,127 M541V probably benign Het
Rhbdf1 G A 11: 32,214,277 R234* probably null Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Satb1 A T 17: 51,740,145 L683Q probably damaging Het
Satb2 T C 1: 56,899,070 T132A probably damaging Het
Sbspon A G 1: 15,860,295 S156P probably damaging Het
Shb A T 4: 45,458,347 probably null Het
She A G 3: 89,849,485 K282R possibly damaging Het
Slc25a13 A G 6: 6,152,482 L85P probably damaging Het
Slc7a13 A T 4: 19,841,578 H475L probably benign Het
Sorl1 C T 9: 42,046,624 V575I probably benign Het
Spag9 T A 11: 94,097,358 C833S possibly damaging Het
Speer2 A C 16: 69,857,164 N232K probably damaging Het
Syncrip A T 9: 88,476,874 M194K probably damaging Het
Taar7f T A 10: 24,049,849 Y114N probably damaging Het
Tap1 C G 17: 34,193,507 P506R probably damaging Het
Tle6 T C 10: 81,595,485 D212G possibly damaging Het
Trim80 G T 11: 115,441,329 E116* probably null Het
Ttll4 A G 1: 74,687,559 R745G probably damaging Het
Vdac2 A T 14: 21,837,879 I85F possibly damaging Het
Vmn1r188 A G 13: 22,088,139 R88G probably damaging Het
Washc2 T C 6: 116,255,091 S821P possibly damaging Het
Wdhd1 T C 14: 47,270,190 Y213C probably damaging Het
Wdr55 C A 18: 36,760,384 P33Q probably damaging Het
Yrdc C T 4: 124,851,946 A32V probably benign Het
Zfp608 T A 18: 54,897,779 K1030* probably null Het
Zfp618 T A 4: 63,132,318 probably null Het
Other mutations in Sytl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Sytl3 APN 17 6735440 missense probably damaging 1.00
IGL02888:Sytl3 APN 17 6733084 missense probably benign
IGL02893:Sytl3 APN 17 6732974 missense probably damaging 1.00
R1462:Sytl3 UTSW 17 6706031 splice site probably benign
R1469:Sytl3 UTSW 17 6687324 missense probably benign 0.17
R1469:Sytl3 UTSW 17 6687324 missense probably benign 0.17
R1735:Sytl3 UTSW 17 6715481 missense probably benign 0.10
R1765:Sytl3 UTSW 17 6699683 missense probably damaging 0.98
R1834:Sytl3 UTSW 17 6728327 missense probably benign 0.05
R1933:Sytl3 UTSW 17 6733046 missense probably damaging 1.00
R1992:Sytl3 UTSW 17 6733049 missense possibly damaging 0.79
R2279:Sytl3 UTSW 17 6708874 intron probably benign
R2411:Sytl3 UTSW 17 6736493 missense probably damaging 1.00
R4019:Sytl3 UTSW 17 6736493 missense probably damaging 1.00
R4853:Sytl3 UTSW 17 6737765 missense probably damaging 0.97
R4857:Sytl3 UTSW 17 6736581 missense probably damaging 1.00
R5169:Sytl3 UTSW 17 6715546 nonsense probably null
R5485:Sytl3 UTSW 17 6715480 missense probably benign 0.03
R6035:Sytl3 UTSW 17 6728265 missense probably damaging 1.00
R6035:Sytl3 UTSW 17 6728265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGCAGAGAATCCATTGG -3'
(R):5'- ATCCAACGCTGTTTGGAAGTCC -3'

Sequencing Primer
(F):5'- CAGAGAATCCATTGGTGCTGTATTC -3'
(R):5'- TTTGGAAGTCCGGCAGAGTCC -3'
Posted On2014-08-01