Mutagenetix > Incidental Mutation

Incidental Mutation 'R1953:Crnkl1'

217442

Institutional Source

Beutler Lab

Gene Symbol

Crnkl1

Ensembl Gene

ENSMUSG00000001767

Gene Name

crooked neck pre-mRNA splicing factor 1

Synonyms

5730590A01Rik, crn, 1200013P10Rik

MMRRC Submission

039967-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R1953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145917479-145935014 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 145928200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 241 (A241V)

Ref Sequence

ENSEMBL: ENSMUSP00000001818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001818]

AlphaFold

P63154

Predicted Effect

probably damaging
Transcript: ENSMUST00000001818
AA Change: A241V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000001818
Gene: ENSMUSG00000001767
AA Change: A241V

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	30	52	N/A	INTRINSIC
HAT	61	93	4.57e-2	SMART
HAT	95	127	3.48e-7	SMART
HAT	129	161	3.33e-4	SMART
HAT	163	194	2.48e-3	SMART
HAT	196	227	1.32e-7	SMART
HAT	229	264	2.11e-6	SMART
HAT	266	300	2.07e0	SMART
Blast:HAT	310	342	1e-13	BLAST
HAT	344	378	3.88e-5	SMART
HAT	388	424	6.86e-6	SMART
HAT	426	457	1.92e2	SMART
HAT	459	491	1.29e-1	SMART
HAT	493	527	2e-7	SMART
HAT	529	560	8.07e-3	SMART
coiled coil region	566	596	N/A	INTRINSIC
low complexity region	655	676	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145425

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147904

Meta Mutation Damage Score

0.1542

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The crooked neck (crn) gene of Drosophila is essential for embryogenesis and is thought to be involved in cell cycle progression and pre-mRNA splicing. A protein encoded by this human locus has been found to localize to pre-mRNA splicing complexes in the nucleus and is necessary for pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	T	16: 38,827,913	T278K	possibly damaging	Het
5730455P16Rik	A	T	11: 80,377,946	D12E	probably damaging	Het
Abca15	C	T	7: 120,361,432	R706C	probably damaging	Het
Actr1a	G	A	19: 46,380,948	S209F	probably benign	Het
Adcy1	A	G	11: 7,078,991	N247S	probably benign	Het
Anapc4	T	C	5: 52,839,688	L101S	probably damaging	Het
Asap3	C	T	4: 136,227,456	R60*	probably null	Het
Ascc3	T	C	10: 50,845,630	S2060P	probably benign	Het
Atp9b	G	A	18: 80,754,307	T851I	possibly damaging	Het
Borcs5	A	G	6: 134,710,267	H196R	unknown	Het
Bpifb9b	A	C	2: 154,311,314	D100A	probably damaging	Het
Cant1	G	C	11: 118,408,783	P247A	probably damaging	Het
Capza3	A	T	6: 140,042,568	I298L	possibly damaging	Het
Cdh10	T	C	15: 18,966,911		probably null	Het
Celsr3	T	C	9: 108,843,182	V2551A	probably benign	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cmtr2	T	C	8: 110,221,919	L287P	probably damaging	Het
Crebbp	G	A	16: 4,179,449	T257I	probably benign	Het
Crispld2	G	A	8: 120,015,296	V128M	probably damaging	Het
Dmd	T	A	X: 83,830,517	I1342N	probably damaging	Het
Dnah10	A	G	5: 124,782,268	T2043A	probably benign	Het
Dscaml1	C	T	9: 45,670,224	T447I	probably benign	Het
Eif2ak3	A	G	6: 70,892,554	T742A	probably benign	Het
Farp1	A	G	14: 121,255,482	T499A	probably benign	Het
Fcgr1	G	A	3: 96,287,070	T167I	probably damaging	Het
Fgd5	C	A	6: 92,024,630	H935Q	probably benign	Het
Fhl4	A	T	10: 85,098,307	D203E	probably benign	Het
Gapt	T	G	13: 110,353,806	T108P	probably damaging	Het
Gm12800	T	C	4: 101,910,115	I187T	probably benign	Het
Gm13762	G	A	2: 88,973,880	Q4*	probably null	Het
Gpt2	A	G	8: 85,521,384	T419A	probably benign	Het
Gucy2c	A	G	6: 136,704,293	V907A	probably damaging	Het
Hmbs	T	C	9: 44,337,444	D211G	probably damaging	Het
Irx5	A	G	8: 92,359,810	N174D	probably damaging	Het
Itfg1	A	G	8: 85,831,231	V170A	probably benign	Het
Itga2b	T	A	11: 102,458,183	T732S	probably benign	Het
Klhl3	A	G	13: 58,011,208	Y546H	probably damaging	Het
Lama5	G	A	2: 180,190,747	H1670Y	possibly damaging	Het
Mlst8	AT	ATT	17: 24,478,013		probably null	Het
Nbeal1	T	C	1: 60,234,840	V409A	probably damaging	Het
Nlgn1	T	A	3: 25,436,300	D421V	probably damaging	Het
Nlrp10	T	C	7: 108,925,118	D385G	probably benign	Het
Nr2e3	T	A	9: 59,949,796	D30V	probably benign	Het
Nyap1	A	G	5: 137,735,032	S580P	probably benign	Het
Olfr1259	A	G	2: 89,943,923	L64P	probably damaging	Het
Olfr1509	T	A	14: 52,450,887	V158E	probably benign	Het
Pex1	A	G	5: 3,630,038	H952R	probably damaging	Het
Plin4	T	A	17: 56,103,849	I1061F	possibly damaging	Het
Pnkp	C	A	7: 44,862,602	R517S	probably benign	Het
Polr2e	T	A	10: 80,038,554	E39D	probably benign	Het
Prokr1	T	C	6: 87,588,593	Y90C	probably benign	Het
Ptprm	A	T	17: 66,940,580	S587T	probably benign	Het
Rere	G	A	4: 150,616,837	E1225K	probably damaging	Het
Rsl24d1	G	T	9: 73,114,614		probably benign	Het
Selp	A	G	1: 164,126,512	N127S	probably benign	Het
Slc22a18	C	T	7: 143,476,247	T17I	probably damaging	Het
Smad2	A	G	18: 76,262,705	T72A	possibly damaging	Het
Snx29	G	A	16: 11,399,783	W149*	probably null	Het
Stk31	G	T	6: 49,446,478		probably null	Het
Sult1e1	T	G	5: 87,587,671		probably null	Het
Syngap1	G	A	17: 26,944,687	R41H	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,398		probably null	Het
Tie1	A	T	4: 118,472,790		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Usp47	T	A	7: 112,092,876	D848E	probably benign	Het
Vmn1r72	A	G	7: 11,669,804	L239P	probably damaging	Het
Vmn2r124	T	C	17: 18,062,860	I272T	probably benign	Het
Vwa1	C	T	4: 155,773,114	V76M	probably damaging	Het
Xrn1	G	T	9: 96,024,221		probably null	Het
Zfp667	G	T	7: 6,305,088	V252F	probably benign	Het
Zranb3	A	T	1: 127,999,399	V343D	probably damaging	Het

Other mutations in Crnkl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Crnkl1	APN	2	145918468	missense	possibly damaging	0.75
IGL01092:Crnkl1	APN	2	145919948	missense	probably benign	0.00
IGL01643:Crnkl1	APN	2	145931348	missense	probably damaging	0.99
IGL01902:Crnkl1	APN	2	145924712	splice site	probably null
IGL01908:Crnkl1	APN	2	145928155	missense	probably benign	0.01
IGL01934:Crnkl1	APN	2	145931282	missense	probably benign	0.02
IGL01947:Crnkl1	APN	2	145921824	missense	probably benign	0.05
IGL02342:Crnkl1	APN	2	145924713	critical splice donor site	probably null
IGL02721:Crnkl1	APN	2	145923881	missense	possibly damaging	0.90
IGL02794:Crnkl1	APN	2	145930612	missense	possibly damaging	0.55
IGL02877:Crnkl1	APN	2	145920671	nonsense	probably null
IGL03131:Crnkl1	APN	2	145932258	missense	probably benign	0.02
R0326:Crnkl1	UTSW	2	145919955	missense	probably benign
R1462:Crnkl1	UTSW	2	145921819	missense	probably damaging	0.97
R1462:Crnkl1	UTSW	2	145921819	missense	probably damaging	0.97
R1471:Crnkl1	UTSW	2	145932316	missense	possibly damaging	0.69
R1951:Crnkl1	UTSW	2	145928200	missense	probably damaging	0.98
R1952:Crnkl1	UTSW	2	145928200	missense	probably damaging	0.98
R2112:Crnkl1	UTSW	2	145930697	nonsense	probably null
R2405:Crnkl1	UTSW	2	145928157	nonsense	probably null
R2972:Crnkl1	UTSW	2	145932261	missense	probably benign	0.07
R2973:Crnkl1	UTSW	2	145932261	missense	probably benign	0.07
R2974:Crnkl1	UTSW	2	145932261	missense	probably benign	0.07
R3801:Crnkl1	UTSW	2	145919795	missense	probably benign
R3811:Crnkl1	UTSW	2	145931306	missense	probably damaging	1.00
R4037:Crnkl1	UTSW	2	145932327	missense	possibly damaging	0.82
R4038:Crnkl1	UTSW	2	145932327	missense	possibly damaging	0.82
R4039:Crnkl1	UTSW	2	145932327	missense	possibly damaging	0.82
R4976:Crnkl1	UTSW	2	145923876	missense	possibly damaging	0.86
R5396:Crnkl1	UTSW	2	145928212	missense	possibly damaging	0.74
R5868:Crnkl1	UTSW	2	145918553	missense	probably benign	0.11
R6245:Crnkl1	UTSW	2	145928131	missense	probably benign	0.03
R6564:Crnkl1	UTSW	2	145928245	missense	possibly damaging	0.67
R7772:Crnkl1	UTSW	2	145930644	missense	probably benign	0.17
R7787:Crnkl1	UTSW	2	145925595	missense	probably benign	0.05
R7829:Crnkl1	UTSW	2	145931349	missense	probably benign	0.20
R8022:Crnkl1	UTSW	2	145918566	missense	probably damaging	0.99
R8045:Crnkl1	UTSW	2	145932931	missense	probably damaging	1.00
R8805:Crnkl1	UTSW	2	145931430	critical splice acceptor site	probably null
R9211:Crnkl1	UTSW	2	145932853	missense	probably damaging	0.99
R9256:Crnkl1	UTSW	2	145928296	missense	possibly damaging	0.68
R9274:Crnkl1	UTSW	2	145923916	missense	probably damaging	1.00
R9525:Crnkl1	UTSW	2	145928278	missense	probably benign	0.02
R9547:Crnkl1	UTSW	2	145930630	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- CCAATGTAGAGCTCAGCAATACATG -3'
(R):5'- AACCTTTGGCATGTGCTGTG -3'

Sequencing Primer
(F):5'- GCATTCAGTTCCGTATTAAATTATGG -3'
(R):5'- CATGTGCTGTGCATGCGC -3'

Posted On

2014-08-01