Incidental Mutation 'R1953:Crnkl1'
ID217442
Institutional Source Beutler Lab
Gene Symbol Crnkl1
Ensembl Gene ENSMUSG00000001767
Gene Namecrooked neck pre-mRNA splicing factor 1
Synonyms5730590A01Rik, crn, 1200013P10Rik
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location145917479-145935014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145928200 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 241 (A241V)
Ref Sequence ENSEMBL: ENSMUSP00000001818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001818]
Predicted Effect probably damaging
Transcript: ENSMUST00000001818
AA Change: A241V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001818
Gene: ENSMUSG00000001767
AA Change: A241V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 30 52 N/A INTRINSIC
HAT 61 93 4.57e-2 SMART
HAT 95 127 3.48e-7 SMART
HAT 129 161 3.33e-4 SMART
HAT 163 194 2.48e-3 SMART
HAT 196 227 1.32e-7 SMART
HAT 229 264 2.11e-6 SMART
HAT 266 300 2.07e0 SMART
Blast:HAT 310 342 1e-13 BLAST
HAT 344 378 3.88e-5 SMART
HAT 388 424 6.86e-6 SMART
HAT 426 457 1.92e2 SMART
HAT 459 491 1.29e-1 SMART
HAT 493 527 2e-7 SMART
HAT 529 560 8.07e-3 SMART
coiled coil region 566 596 N/A INTRINSIC
low complexity region 655 676 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147904
Meta Mutation Damage Score 0.1542 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The crooked neck (crn) gene of Drosophila is essential for embryogenesis and is thought to be involved in cell cycle progression and pre-mRNA splicing. A protein encoded by this human locus has been found to localize to pre-mRNA splicing complexes in the nucleus and is necessary for pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Crnkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Crnkl1 APN 2 145918468 missense possibly damaging 0.75
IGL01092:Crnkl1 APN 2 145919948 missense probably benign 0.00
IGL01643:Crnkl1 APN 2 145931348 missense probably damaging 0.99
IGL01902:Crnkl1 APN 2 145924712 splice site probably null
IGL01908:Crnkl1 APN 2 145928155 missense probably benign 0.01
IGL01934:Crnkl1 APN 2 145931282 missense probably benign 0.02
IGL01947:Crnkl1 APN 2 145921824 missense probably benign 0.05
IGL02342:Crnkl1 APN 2 145924713 critical splice donor site probably null
IGL02721:Crnkl1 APN 2 145923881 missense possibly damaging 0.90
IGL02794:Crnkl1 APN 2 145930612 missense possibly damaging 0.55
IGL02877:Crnkl1 APN 2 145920671 nonsense probably null
IGL03131:Crnkl1 APN 2 145932258 missense probably benign 0.02
R0326:Crnkl1 UTSW 2 145919955 missense probably benign
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1471:Crnkl1 UTSW 2 145932316 missense possibly damaging 0.69
R1951:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1952:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R2112:Crnkl1 UTSW 2 145930697 nonsense probably null
R2405:Crnkl1 UTSW 2 145928157 nonsense probably null
R2972:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2973:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2974:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R3801:Crnkl1 UTSW 2 145919795 missense probably benign
R3811:Crnkl1 UTSW 2 145931306 missense probably damaging 1.00
R4037:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4038:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4039:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4976:Crnkl1 UTSW 2 145923876 missense possibly damaging 0.86
R5396:Crnkl1 UTSW 2 145928212 missense possibly damaging 0.74
R5868:Crnkl1 UTSW 2 145918553 missense probably benign 0.11
R6245:Crnkl1 UTSW 2 145928131 missense probably benign 0.03
R6564:Crnkl1 UTSW 2 145928245 missense possibly damaging 0.67
R7772:Crnkl1 UTSW 2 145930644 missense probably benign 0.17
R7787:Crnkl1 UTSW 2 145925595 missense probably benign 0.05
R7829:Crnkl1 UTSW 2 145931349 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCAATGTAGAGCTCAGCAATACATG -3'
(R):5'- AACCTTTGGCATGTGCTGTG -3'

Sequencing Primer
(F):5'- GCATTCAGTTCCGTATTAAATTATGG -3'
(R):5'- CATGTGCTGTGCATGCGC -3'
Posted On2014-08-01