Incidental Mutation 'R1953:Asap3'
ID217451
Institutional Source Beutler Lab
Gene Symbol Asap3
Ensembl Gene ENSMUSG00000036995
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 3
SynonymsUPLC1, 9430088F20Rik, Ddefl1
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1953 (G1)
Quality Score214
Status Not validated
Chromosome4
Chromosomal Location136206365-136245216 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 136227456 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 60 (R60*)
Ref Sequence ENSEMBL: ENSMUSP00000041899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047526]
Predicted Effect probably null
Transcript: ENSMUST00000047526
AA Change: R60*
SMART Domains Protein: ENSMUSP00000041899
Gene: ENSMUSG00000036995
AA Change: R60*

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
Pfam:BAR_3 32 264 5.5e-20 PFAM
PH 303 396 5.61e-17 SMART
ArfGap 425 547 8.33e-31 SMART
ANK 584 616 4.86e1 SMART
ANK 620 649 3.06e-5 SMART
low complexity region 794 806 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Asap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Asap3 APN 4 136206568 missense probably damaging 1.00
IGL01865:Asap3 APN 4 136236404 missense probably damaging 1.00
IGL02045:Asap3 APN 4 136227441 missense probably benign 0.01
IGL02105:Asap3 APN 4 136228474 critical splice donor site probably null
IGL02135:Asap3 APN 4 136241153 critical splice acceptor site probably null
IGL02484:Asap3 APN 4 136229457 splice site probably benign
IGL02524:Asap3 APN 4 136238616 missense probably damaging 1.00
IGL02881:Asap3 APN 4 136239237 missense probably benign 0.00
R0128:Asap3 UTSW 4 136234604 missense probably damaging 0.99
R0883:Asap3 UTSW 4 136234325 splice site probably benign
R0903:Asap3 UTSW 4 136238376 missense probably benign
R1073:Asap3 UTSW 4 136236431 missense probably damaging 1.00
R1498:Asap3 UTSW 4 136239194 missense probably benign
R1951:Asap3 UTSW 4 136227456 nonsense probably null
R3703:Asap3 UTSW 4 136241241 small insertion probably benign
R3704:Asap3 UTSW 4 136241241 small insertion probably benign
R3705:Asap3 UTSW 4 136241241 small insertion probably benign
R3754:Asap3 UTSW 4 136229455 splice site probably null
R3773:Asap3 UTSW 4 136227575 missense probably benign 0.22
R3911:Asap3 UTSW 4 136229457 splice site probably benign
R4570:Asap3 UTSW 4 136240185 missense probably damaging 0.99
R4879:Asap3 UTSW 4 136242664 missense probably benign 0.04
R5394:Asap3 UTSW 4 136241259 missense probably benign 0.00
R5497:Asap3 UTSW 4 136239222 missense probably benign 0.13
R5914:Asap3 UTSW 4 136241409 missense probably benign 0.18
R6208:Asap3 UTSW 4 136241197 missense probably benign
R6214:Asap3 UTSW 4 136241425 missense possibly damaging 0.80
R6495:Asap3 UTSW 4 136228479 splice site probably null
R6577:Asap3 UTSW 4 136238230 splice site probably null
R6823:Asap3 UTSW 4 136227572 missense possibly damaging 0.95
R7067:Asap3 UTSW 4 136241362 splice site probably null
R7081:Asap3 UTSW 4 136241570 critical splice donor site probably null
R7471:Asap3 UTSW 4 136233646 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTCTGTGCATGCACTCTGT -3'
(R):5'- CTCGTGGCTGTTTTGAGACAAG -3'

Sequencing Primer
(F):5'- ACTCTGTGCATGCACTCTGTATGAG -3'
(R):5'- TTGAGACAAGTGACTATTCCCCAAGG -3'
Posted On2014-08-01