Mutagenetix > Incidental Mutations

Incidental Mutation 'R1953:Anapc4'

217455

Institutional Source

Beutler Lab

Gene Symbol

Anapc4

Ensembl Gene

ENSMUSG00000029176

Gene Name

anaphase promoting complex subunit 4

Synonyms

2610306D21Rik, D5Ertd249e, APC4

MMRRC Submission

039967-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52834012-52867797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52839688 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 101 (L101S)

Ref Sequence

ENSEMBL: ENSMUSP00000031072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031072
AA Change: L101S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: L101S

Domain	Start	End	E-Value	Type
Pfam:ANAPC4_WD40	10	57	9.1e-18	PFAM
low complexity region	137	147	N/A	INTRINSIC
Pfam:ANAPC4	232	431	3.7e-61	PFAM
low complexity region	747	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130536

Predicted Effect

probably benign
Transcript: ENSMUST00000144574

SMART Domains

Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

Domain	Start	End	E-Value	Type
Pfam:Apc4_WD40	10	57	4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150682

Predicted Effect

probably benign
Transcript: ENSMUST00000198207

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	T	16: 38,827,913	T278K	possibly damaging	Het
5730455P16Rik	A	T	11: 80,377,946	D12E	probably damaging	Het
Abca15	C	T	7: 120,361,432	R706C	probably damaging	Het
Actr1a	G	A	19: 46,380,948	S209F	probably benign	Het
Adcy1	A	G	11: 7,078,991	N247S	probably benign	Het
Asap3	C	T	4: 136,227,456	R60*	probably null	Het
Ascc3	T	C	10: 50,845,630	S2060P	probably benign	Het
Atp9b	G	A	18: 80,754,307	T851I	possibly damaging	Het
Borcs5	A	G	6: 134,710,267	H196R	unknown	Het
Bpifb9b	A	C	2: 154,311,314	D100A	probably damaging	Het
Cant1	G	C	11: 118,408,783	P247A	probably damaging	Het
Capza3	A	T	6: 140,042,568	I298L	possibly damaging	Het
Cdh10	T	C	15: 18,966,911		probably null	Het
Celsr3	T	C	9: 108,843,182	V2551A	probably benign	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cmtr2	T	C	8: 110,221,919	L287P	probably damaging	Het
Crebbp	G	A	16: 4,179,449	T257I	probably benign	Het
Crispld2	G	A	8: 120,015,296	V128M	probably damaging	Het
Crnkl1	G	A	2: 145,928,200	A241V	probably damaging	Het
Dmd	T	A	X: 83,830,517	I1342N	probably damaging	Het
Dnah10	A	G	5: 124,782,268	T2043A	probably benign	Het
Dscaml1	C	T	9: 45,670,224	T447I	probably benign	Het
Eif2ak3	A	G	6: 70,892,554	T742A	probably benign	Het
Farp1	A	G	14: 121,255,482	T499A	probably benign	Het
Fcgr1	G	A	3: 96,287,070	T167I	probably damaging	Het
Fgd5	C	A	6: 92,024,630	H935Q	probably benign	Het
Fhl4	A	T	10: 85,098,307	D203E	probably benign	Het
Gapt	T	G	13: 110,353,806	T108P	probably damaging	Het
Gm12800	T	C	4: 101,910,115	I187T	probably benign	Het
Gm13762	G	A	2: 88,973,880	Q4*	probably null	Het
Gpt2	A	G	8: 85,521,384	T419A	probably benign	Het
Gucy2c	A	G	6: 136,704,293	V907A	probably damaging	Het
Hmbs	T	C	9: 44,337,444	D211G	probably damaging	Het
Irx5	A	G	8: 92,359,810	N174D	probably damaging	Het
Itfg1	A	G	8: 85,831,231	V170A	probably benign	Het
Itga2b	T	A	11: 102,458,183	T732S	probably benign	Het
Klhl3	A	G	13: 58,011,208	Y546H	probably damaging	Het
Lama5	G	A	2: 180,190,747	H1670Y	possibly damaging	Het
Mlst8	AT	ATT	17: 24,478,013		probably null	Het
Nbeal1	T	C	1: 60,234,840	V409A	probably damaging	Het
Nlgn1	T	A	3: 25,436,300	D421V	probably damaging	Het
Nlrp10	T	C	7: 108,925,118	D385G	probably benign	Het
Nr2e3	T	A	9: 59,949,796	D30V	probably benign	Het
Nyap1	A	G	5: 137,735,032	S580P	probably benign	Het
Olfr1259	A	G	2: 89,943,923	L64P	probably damaging	Het
Olfr1509	T	A	14: 52,450,887	V158E	probably benign	Het
Pex1	A	G	5: 3,630,038	H952R	probably damaging	Het
Plin4	T	A	17: 56,103,849	I1061F	possibly damaging	Het
Pnkp	C	A	7: 44,862,602	R517S	probably benign	Het
Polr2e	T	A	10: 80,038,554	E39D	probably benign	Het
Prokr1	T	C	6: 87,588,593	Y90C	probably benign	Het
Ptprm	A	T	17: 66,940,580	S587T	probably benign	Het
Rere	G	A	4: 150,616,837	E1225K	probably damaging	Het
Rsl24d1	G	T	9: 73,114,614		probably benign	Het
Selp	A	G	1: 164,126,512	N127S	probably benign	Het
Slc22a18	C	T	7: 143,476,247	T17I	probably damaging	Het
Smad2	A	G	18: 76,262,705	T72A	possibly damaging	Het
Snx29	G	A	16: 11,399,783	W149*	probably null	Het
Stk31	G	T	6: 49,446,478		probably null	Het
Sult1e1	T	G	5: 87,587,671		probably null	Het
Syngap1	G	A	17: 26,944,687	R41H	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,398		probably null	Het
Tie1	A	T	4: 118,472,790		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Usp47	T	A	7: 112,092,876	D848E	probably benign	Het
Vmn1r72	A	G	7: 11,669,804	L239P	probably damaging	Het
Vmn2r124	T	C	17: 18,062,860	I272T	probably benign	Het
Vwa1	C	T	4: 155,773,114	V76M	probably damaging	Het
Xrn1	G	T	9: 96,024,221		probably null	Het
Zfp667	G	T	7: 6,305,088	V252F	probably benign	Het
Zranb3	A	T	1: 127,999,399	V343D	probably damaging	Het

Other mutations in Anapc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Anapc4	APN	5	52857211	missense	probably damaging	0.98
IGL01066:Anapc4	APN	5	52857209	missense	probably benign	0.08
IGL01109:Anapc4	APN	5	52848628	missense	probably damaging	1.00
IGL01657:Anapc4	APN	5	52864626	nonsense	probably null
IGL02692:Anapc4	APN	5	52864529	missense	probably damaging	0.98
IGL02734:Anapc4	APN	5	52861291	missense	probably benign	0.04
IGL03089:Anapc4	APN	5	52866398	missense	probably benign	0.32
IGL03096:Anapc4	APN	5	52865929	missense	possibly damaging	0.57
FR4304:Anapc4	UTSW	5	52864526	missense	probably damaging	1.00
IGL03048:Anapc4	UTSW	5	52839733	missense	probably benign	0.00
R0331:Anapc4	UTSW	5	52855642	splice site	probably benign
R0511:Anapc4	UTSW	5	52842017	unclassified	probably benign
R0624:Anapc4	UTSW	5	52845419	splice site	probably benign
R0919:Anapc4	UTSW	5	52855637	missense	probably benign	0.18
R1935:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1936:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1942:Anapc4	UTSW	5	52846714	missense	probably benign	0.30
R1954:Anapc4	UTSW	5	52846625	intron	probably benign
R2341:Anapc4	UTSW	5	52841937	unclassified	probably benign
R3696:Anapc4	UTSW	5	52862009	missense	probably null	0.01
R4506:Anapc4	UTSW	5	52835730	missense	possibly damaging	0.79
R4596:Anapc4	UTSW	5	52841718	missense	probably benign	0.00
R5234:Anapc4	UTSW	5	52848776	missense	probably damaging	1.00
R5256:Anapc4	UTSW	5	52863594	missense	probably benign
R5310:Anapc4	UTSW	5	52859159	missense	probably benign	0.00
R5401:Anapc4	UTSW	5	52863649	missense	probably benign	0.01
R5409:Anapc4	UTSW	5	52848599	missense	probably damaging	0.98
R5525:Anapc4	UTSW	5	52856809	missense	probably damaging	1.00
R5575:Anapc4	UTSW	5	52855871	missense	probably damaging	1.00
R5604:Anapc4	UTSW	5	52841734	nonsense	probably null
R5695:Anapc4	UTSW	5	52862239	missense	probably benign	0.00
R5955:Anapc4	UTSW	5	52865946	missense	probably benign	0.01
R5974:Anapc4	UTSW	5	52845400	missense	probably damaging	1.00
R6458:Anapc4	UTSW	5	52864553	missense	possibly damaging	0.80
R6537:Anapc4	UTSW	5	52843556	missense	probably damaging	0.98
R6633:Anapc4	UTSW	5	52865946	missense	possibly damaging	0.85
R6860:Anapc4	UTSW	5	52848828	missense	probably damaging	1.00
R6965:Anapc4	UTSW	5	52835751	missense	possibly damaging	0.89
R7067:Anapc4	UTSW	5	52862235	missense	probably benign
R7327:Anapc4	UTSW	5	52845330	missense	probably damaging	0.99
R7442:Anapc4	UTSW	5	52857201	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CGTCAAGGCAAAAGCGATTG -3'
(R):5'- CAAGCTCTGAAAACTTCTCCAG -3'

Sequencing Primer
(F):5'- CATGTGTTCCGTCAGAGGACAG -3'
(R):5'- GTCATCCAGAATCTACCTACGGTC -3'

Posted On

2014-08-01