Incidental Mutation 'R1953:Sult1e1'
ID217456
Institutional Source Beutler Lab
Gene Symbol Sult1e1
Ensembl Gene ENSMUSG00000029272
Gene Namesulfotransferase family 1E, member 1
SynonymsEST, Ste
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87575969-87591594 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 87587671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031201]
Predicted Effect probably null
Transcript: ENSMUST00000031201
SMART Domains Protein: ENSMUSP00000031201
Gene: ENSMUSG00000029272

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 288 1.1e-91 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that transfers a sulfo moiety to and from estrone, which may control levels of estrogen receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced fertility. Males exhibit abnormal testis morphology with Leydig cell hypertrophy and hyperplasia and reduced caudal sperm motility. Spontaneous fetal loss caused by placental thrombosis occurs in pregnant females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Sult1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Sult1e1 APN 5 87576301 missense probably damaging 1.00
IGL01588:Sult1e1 APN 5 87576243 missense probably benign 0.01
IGL02685:Sult1e1 APN 5 87579906 nonsense probably null
IGL03083:Sult1e1 APN 5 87590124 missense probably benign
IGL03137:Sult1e1 APN 5 87578616 missense probably benign 0.00
IGL03217:Sult1e1 APN 5 87590088 missense possibly damaging 0.46
R0069:Sult1e1 UTSW 5 87579897 missense probably damaging 1.00
R0069:Sult1e1 UTSW 5 87579897 missense probably damaging 1.00
R0456:Sult1e1 UTSW 5 87578634 missense possibly damaging 0.86
R1446:Sult1e1 UTSW 5 87578537 missense probably damaging 1.00
R2697:Sult1e1 UTSW 5 87578538 missense probably damaging 1.00
R4791:Sult1e1 UTSW 5 87586730 missense possibly damaging 0.61
R4799:Sult1e1 UTSW 5 87590168 missense possibly damaging 0.70
R5103:Sult1e1 UTSW 5 87576232 missense probably benign
R5158:Sult1e1 UTSW 5 87587594 missense probably damaging 1.00
R5219:Sult1e1 UTSW 5 87578586 missense probably damaging 0.98
R6148:Sult1e1 UTSW 5 87579911 missense probably damaging 1.00
R6530:Sult1e1 UTSW 5 87576288 missense probably benign 0.18
R6866:Sult1e1 UTSW 5 87586766 missense probably damaging 1.00
R7295:Sult1e1 UTSW 5 87578653 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCTTATTACAACACAGCCATATC -3'
(R):5'- AACGCCAAAATTCAACGTGGG -3'

Sequencing Primer
(F):5'- AGGTCTTCGTTTCTGCAC -3'
(R):5'- CCAAAATTCAACGTGGGAGGCTC -3'
Posted On2014-08-01