Mutagenetix > Incidental Mutations

Incidental Mutation 'R1953:Sult1e1'

217456

Institutional Source

Beutler Lab

Gene Symbol

Sult1e1

Ensembl Gene

ENSMUSG00000029272

Gene Name

sulfotransferase family 1E, member 1

Synonyms

EST, Ste

MMRRC Submission

039967-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R1953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87575969-87591594 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to G at 87587671 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031201]

Predicted Effect

probably null
Transcript: ENSMUST00000031201

SMART Domains

Protein: ENSMUSP00000031201
Gene: ENSMUSG00000029272

Domain	Start	End	E-Value	Type
Pfam:Sulfotransfer_1	38	288	1.1e-91	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that transfers a sulfo moiety to and from estrone, which may control levels of estrogen receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced fertility. Males exhibit abnormal testis morphology with Leydig cell hypertrophy and hyperplasia and reduced caudal sperm motility. Spontaneous fetal loss caused by placental thrombosis occurs in pregnant females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	T	16: 38,827,913	T278K	possibly damaging	Het
5730455P16Rik	A	T	11: 80,377,946	D12E	probably damaging	Het
Abca15	C	T	7: 120,361,432	R706C	probably damaging	Het
Actr1a	G	A	19: 46,380,948	S209F	probably benign	Het
Adcy1	A	G	11: 7,078,991	N247S	probably benign	Het
Anapc4	T	C	5: 52,839,688	L101S	probably damaging	Het
Asap3	C	T	4: 136,227,456	R60*	probably null	Het
Ascc3	T	C	10: 50,845,630	S2060P	probably benign	Het
Atp9b	G	A	18: 80,754,307	T851I	possibly damaging	Het
Borcs5	A	G	6: 134,710,267	H196R	unknown	Het
Bpifb9b	A	C	2: 154,311,314	D100A	probably damaging	Het
Cant1	G	C	11: 118,408,783	P247A	probably damaging	Het
Capza3	A	T	6: 140,042,568	I298L	possibly damaging	Het
Cdh10	T	C	15: 18,966,911		probably null	Het
Celsr3	T	C	9: 108,843,182	V2551A	probably benign	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cmtr2	T	C	8: 110,221,919	L287P	probably damaging	Het
Crebbp	G	A	16: 4,179,449	T257I	probably benign	Het
Crispld2	G	A	8: 120,015,296	V128M	probably damaging	Het
Crnkl1	G	A	2: 145,928,200	A241V	probably damaging	Het
Dmd	T	A	X: 83,830,517	I1342N	probably damaging	Het
Dnah10	A	G	5: 124,782,268	T2043A	probably benign	Het
Dscaml1	C	T	9: 45,670,224	T447I	probably benign	Het
Eif2ak3	A	G	6: 70,892,554	T742A	probably benign	Het
Farp1	A	G	14: 121,255,482	T499A	probably benign	Het
Fcgr1	G	A	3: 96,287,070	T167I	probably damaging	Het
Fgd5	C	A	6: 92,024,630	H935Q	probably benign	Het
Fhl4	A	T	10: 85,098,307	D203E	probably benign	Het
Gapt	T	G	13: 110,353,806	T108P	probably damaging	Het
Gm12800	T	C	4: 101,910,115	I187T	probably benign	Het
Gm13762	G	A	2: 88,973,880	Q4*	probably null	Het
Gpt2	A	G	8: 85,521,384	T419A	probably benign	Het
Gucy2c	A	G	6: 136,704,293	V907A	probably damaging	Het
Hmbs	T	C	9: 44,337,444	D211G	probably damaging	Het
Irx5	A	G	8: 92,359,810	N174D	probably damaging	Het
Itfg1	A	G	8: 85,831,231	V170A	probably benign	Het
Itga2b	T	A	11: 102,458,183	T732S	probably benign	Het
Klhl3	A	G	13: 58,011,208	Y546H	probably damaging	Het
Lama5	G	A	2: 180,190,747	H1670Y	possibly damaging	Het
Mlst8	AT	ATT	17: 24,478,013		probably null	Het
Nbeal1	T	C	1: 60,234,840	V409A	probably damaging	Het
Nlgn1	T	A	3: 25,436,300	D421V	probably damaging	Het
Nlrp10	T	C	7: 108,925,118	D385G	probably benign	Het
Nr2e3	T	A	9: 59,949,796	D30V	probably benign	Het
Nyap1	A	G	5: 137,735,032	S580P	probably benign	Het
Olfr1259	A	G	2: 89,943,923	L64P	probably damaging	Het
Olfr1509	T	A	14: 52,450,887	V158E	probably benign	Het
Pex1	A	G	5: 3,630,038	H952R	probably damaging	Het
Plin4	T	A	17: 56,103,849	I1061F	possibly damaging	Het
Pnkp	C	A	7: 44,862,602	R517S	probably benign	Het
Polr2e	T	A	10: 80,038,554	E39D	probably benign	Het
Prokr1	T	C	6: 87,588,593	Y90C	probably benign	Het
Ptprm	A	T	17: 66,940,580	S587T	probably benign	Het
Rere	G	A	4: 150,616,837	E1225K	probably damaging	Het
Rsl24d1	G	T	9: 73,114,614		probably benign	Het
Selp	A	G	1: 164,126,512	N127S	probably benign	Het
Slc22a18	C	T	7: 143,476,247	T17I	probably damaging	Het
Smad2	A	G	18: 76,262,705	T72A	possibly damaging	Het
Snx29	G	A	16: 11,399,783	W149*	probably null	Het
Stk31	G	T	6: 49,446,478		probably null	Het
Syngap1	G	A	17: 26,944,687	R41H	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,398		probably null	Het
Tie1	A	T	4: 118,472,790		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Usp47	T	A	7: 112,092,876	D848E	probably benign	Het
Vmn1r72	A	G	7: 11,669,804	L239P	probably damaging	Het
Vmn2r124	T	C	17: 18,062,860	I272T	probably benign	Het
Vwa1	C	T	4: 155,773,114	V76M	probably damaging	Het
Xrn1	G	T	9: 96,024,221		probably null	Het
Zfp667	G	T	7: 6,305,088	V252F	probably benign	Het
Zranb3	A	T	1: 127,999,399	V343D	probably damaging	Het

Other mutations in Sult1e1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01504:Sult1e1	APN	5	87576301	missense	probably damaging	1.00
IGL01588:Sult1e1	APN	5	87576243	missense	probably benign	0.01
IGL02685:Sult1e1	APN	5	87579906	nonsense	probably null
IGL03083:Sult1e1	APN	5	87590124	missense	probably benign
IGL03137:Sult1e1	APN	5	87578616	missense	probably benign	0.00
IGL03217:Sult1e1	APN	5	87590088	missense	possibly damaging	0.46
R0069:Sult1e1	UTSW	5	87579897	missense	probably damaging	1.00
R0069:Sult1e1	UTSW	5	87579897	missense	probably damaging	1.00
R0456:Sult1e1	UTSW	5	87578634	missense	possibly damaging	0.86
R1446:Sult1e1	UTSW	5	87578537	missense	probably damaging	1.00
R2697:Sult1e1	UTSW	5	87578538	missense	probably damaging	1.00
R4791:Sult1e1	UTSW	5	87586730	missense	possibly damaging	0.61
R4799:Sult1e1	UTSW	5	87590168	missense	possibly damaging	0.70
R5103:Sult1e1	UTSW	5	87576232	missense	probably benign
R5158:Sult1e1	UTSW	5	87587594	missense	probably damaging	1.00
R5219:Sult1e1	UTSW	5	87578586	missense	probably damaging	0.98
R6148:Sult1e1	UTSW	5	87579911	missense	probably damaging	1.00
R6530:Sult1e1	UTSW	5	87576288	missense	probably benign	0.18
R6866:Sult1e1	UTSW	5	87586766	missense	probably damaging	1.00
R7295:Sult1e1	UTSW	5	87578653	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTCTTATTACAACACAGCCATATC -3'
(R):5'- AACGCCAAAATTCAACGTGGG -3'

Sequencing Primer
(F):5'- AGGTCTTCGTTTCTGCAC -3'
(R):5'- CCAAAATTCAACGTGGGAGGCTC -3'

Posted On

2014-08-01