Incidental Mutation 'R1953:Eif2ak3'
ID217461
Institutional Source Beutler Lab
Gene Symbol Eif2ak3
Ensembl Gene ENSMUSG00000031668
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 3
SynonymsPERK
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.718) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location70844515-70905245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70892554 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 742 (T742A)
Ref Sequence ENSEMBL: ENSMUSP00000034093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034093]
Predicted Effect probably benign
Transcript: ENSMUST00000034093
AA Change: T742A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034093
Gene: ENSMUSG00000031668
AA Change: T742A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 48 82 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 221 230 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Pfam:Pkinase_Tyr 589 662 1.6e-6 PFAM
Pfam:Pkinase 589 673 3.2e-12 PFAM
Pfam:Pkinase 839 1075 1.9e-38 PFAM
Pfam:Pkinase_Tyr 859 1073 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161316
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. Mutations in a similar gene in human are associated with Wolcott-Rallison syndrome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice develop exocrine pancreatic insufficiency and progressive diabetes mellitus. They are growth retarded, hyperglycemic, exhibit increased cell death in the pancreas, have decreased numbers of pancreatic beta cells and about half diebefore weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Eif2ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Eif2ak3 APN 6 70892726 missense probably damaging 1.00
IGL02069:Eif2ak3 APN 6 70896965 missense probably damaging 1.00
IGL02197:Eif2ak3 APN 6 70901457 missense probably benign 0.37
IGL03150:Eif2ak3 APN 6 70892436 missense possibly damaging 0.68
R0024:Eif2ak3 UTSW 6 70892356 missense probably benign 0.01
R0130:Eif2ak3 UTSW 6 70881732 splice site probably benign
R0394:Eif2ak3 UTSW 6 70885218 missense probably benign 0.03
R0699:Eif2ak3 UTSW 6 70892530 missense probably benign 0.16
R1648:Eif2ak3 UTSW 6 70883631 missense possibly damaging 0.52
R1708:Eif2ak3 UTSW 6 70887806 missense probably damaging 0.99
R2062:Eif2ak3 UTSW 6 70904197 missense probably benign 0.02
R2875:Eif2ak3 UTSW 6 70883639 missense probably damaging 1.00
R4260:Eif2ak3 UTSW 6 70889513 missense probably damaging 0.98
R4357:Eif2ak3 UTSW 6 70884875 missense probably damaging 0.98
R4786:Eif2ak3 UTSW 6 70892618 missense possibly damaging 0.95
R4801:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R4802:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R5194:Eif2ak3 UTSW 6 70858478 missense possibly damaging 0.83
R5260:Eif2ak3 UTSW 6 70893129 missense probably damaging 1.00
R5710:Eif2ak3 UTSW 6 70883733 missense probably damaging 1.00
R5724:Eif2ak3 UTSW 6 70876840 missense probably benign 0.19
R6089:Eif2ak3 UTSW 6 70896934 missense possibly damaging 0.87
R6656:Eif2ak3 UTSW 6 70883715 missense probably damaging 1.00
R6940:Eif2ak3 UTSW 6 70892402 missense possibly damaging 0.82
R6949:Eif2ak3 UTSW 6 70878845 missense probably damaging 0.99
R6958:Eif2ak3 UTSW 6 70892683 missense probably benign 0.01
R7168:Eif2ak3 UTSW 6 70881626 missense probably benign
R7627:Eif2ak3 UTSW 6 70892935 missense probably benign 0.01
R8322:Eif2ak3 UTSW 6 70878919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAGCACAGACTGGCCGC -3'
(R):5'- CTCAAACACTATGGAGGAGGAC -3'

Sequencing Primer
(F):5'- CTCCCCTAGCCCGATGGATG -3'
(R):5'- CACTATGGAGGAGGACGTTCC -3'
Posted On2014-08-01