Mutagenetix > Incidental Mutation

Incidental Mutation 'R0133:Blm'

21747

Institutional Source

Beutler Lab

Gene Symbol

Blm

Ensembl Gene

ENSMUSG00000030528

Gene Name

Bloom syndrome, RecQ like helicase

Synonyms

MMRRC Submission

038418-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0133 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

80454733-80535119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80502367 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 611 (I611F)

Ref Sequence

ENSEMBL: ENSMUSP00000127995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]

AlphaFold

O88700

Predicted Effect

probably benign
Transcript: ENSMUST00000081314
AA Change: I608F

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: I608F

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	219	231	N/A	INTRINSIC
low complexity region	318	335	N/A	INTRINSIC
Pfam:BDHCT	376	416	5.5e-27	PFAM
low complexity region	557	574	N/A	INTRINSIC
DEXDc	672	873	1.59e-29	SMART
HELICc	910	992	1.29e-24	SMART
RQC	1084	1198	1.43e-15	SMART
HRDC	1217	1297	9.4e-20	SMART
low complexity region	1357	1371	N/A	INTRINSIC
low complexity region	1378	1392	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170315
AA Change: I611F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: I611F

Domain	Start	End	E-Value	Type
Pfam:BLM_N	4	375	1.1e-161	PFAM
Pfam:BDHCT	380	419	6.4e-25	PFAM
Pfam:BDHCT_assoc	433	658	8.8e-108	PFAM
DEXDc	675	876	1.59e-29	SMART
HELICc	913	995	1.29e-24	SMART
Pfam:RecQ_Zn_bind	1006	1078	1.5e-19	PFAM
RQC	1087	1201	1.43e-15	SMART
HRDC	1220	1300	9.4e-20	SMART
low complexity region	1360	1374	N/A	INTRINSIC
low complexity region	1381	1395	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205263

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 95.2%
20x: 89.4%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	C	11: 103,105,388	S172P	probably damaging	Het
Akap6	A	T	12: 53,139,471	K1223*	probably null	Het
Akna	G	A	4: 63,379,361	Q819*	probably null	Het
Ankrd2	T	C	19: 42,044,071	V257A	probably benign	Het
Arap1	T	A	7: 101,386,229	D30E	probably damaging	Het
Atp6v0d2	T	C	4: 19,910,578		probably benign	Het
Ccng2	A	G	5: 93,273,381	K250R	probably benign	Het
Cdhr3	A	G	12: 33,092,752	L8P	possibly damaging	Het
Csf2rb	T	G	15: 78,339,004		probably benign	Het
Ctbs	A	G	3: 146,457,468	I204V	probably benign	Het
Cxcl16	T	A	11: 70,458,770	E76D	possibly damaging	Het
Dhx15	T	C	5: 52,154,072	I689V	possibly damaging	Het
Dlk2	T	C	17: 46,298,942		probably benign	Het
Dnah2	A	T	11: 69,421,009	M4452K	probably damaging	Het
Dok4	T	A	8: 94,865,363	I280F	probably benign	Het
Dsc3	T	C	18: 19,971,582	T563A	probably damaging	Het
Dsg1b	C	T	18: 20,404,878	A617V	probably damaging	Het
Eps8l2	C	T	7: 141,362,207	P721S	unknown	Het
Evx2	T	C	2: 74,659,082	D112G	possibly damaging	Het
Fam124a	C	A	14: 62,606,333	T430K	possibly damaging	Het
Fbrs	C	T	7: 127,489,610		probably benign	Het
Fbxw14	T	C	9: 109,274,579	T22A	probably benign	Het
Fmo5	T	G	3: 97,645,636	V300G	probably damaging	Het
Gadl1	T	C	9: 115,941,343	S75P	probably benign	Het
Galnt2	T	G	8: 124,338,538	I469S	probably benign	Het
Gga3	T	A	11: 115,588,979		probably benign	Het
Gm10647	T	C	9: 66,798,489		probably benign	Het
Gm14180	C	A	11: 99,734,217	C25F	unknown	Het
Grid2	A	T	6: 64,320,132	D493V	probably damaging	Het
Gzmc	T	A	14: 56,232,297	Y182F	possibly damaging	Het
Hecw2	A	C	1: 53,830,740	L1443R	probably damaging	Het
Igkv4-62	A	G	6: 69,400,069	I32T	probably benign	Het
Ikzf1	T	A	11: 11,741,015		probably null	Het
Il27ra	G	A	8: 84,033,942		probably benign	Het
Jmjd1c	C	A	10: 67,240,808	A2137D	probably benign	Het
Kcnc2	T	C	10: 112,458,597	C579R	probably damaging	Het
Kdr	T	C	5: 75,951,838	T862A	probably damaging	Het
Kif17	T	C	4: 138,278,245	S182P	possibly damaging	Het
Klf5	A	T	14: 99,301,882	T164S	probably benign	Het
Ksr2	T	G	5: 117,555,294	V269G	possibly damaging	Het
Mcm5	T	A	8: 75,120,911	D445E	probably damaging	Het
Mlkl	T	C	8: 111,327,948	I186V	probably damaging	Het
Muc4	A	T	16: 32,771,604	S3017C	possibly damaging	Het
Myo15	T	C	11: 60,477,850	F479L	possibly damaging	Het
Myo6	A	G	9: 80,273,975		probably benign	Het
Myom1	T	A	17: 71,047,787	V393E	probably damaging	Het
Nup98	T	A	7: 102,139,652		probably null	Het
Odf2l	A	G	3: 145,148,541	N383S	probably damaging	Het
Olfml3	A	C	3: 103,737,026		probably null	Het
Olfr1057	A	T	2: 86,374,815	V199E	possibly damaging	Het
Olfr1494	T	A	19: 13,749,988	I294N	probably damaging	Het
Olfr1537	A	G	9: 39,238,011	Y141H	probably benign	Het
Olfr829	G	A	9: 18,856,629	M1I	probably null	Het
Plxna4	A	T	6: 32,197,074	D1195E	probably benign	Het
Ppp1r1a	T	A	15: 103,537,820	H20L	probably damaging	Het
Prdm4	A	G	10: 85,910,221		probably null	Het
Prom2	A	G	2: 127,538,338		probably benign	Het
Rasal3	T	C	17: 32,403,383	M1V	probably null	Het
Rhoj	A	G	12: 75,394,420		probably null	Het
Rnf40	C	T	7: 127,596,860		probably null	Het
Slc15a3	T	C	19: 10,843,250	L77P	probably damaging	Het
Slc26a6	T	C	9: 108,861,323	V586A	possibly damaging	Het
Slc30a10	T	A	1: 185,455,173	L37Q	probably damaging	Het
Slc43a2	T	A	11: 75,563,577	M316K	probably benign	Het
Smarcal1	T	C	1: 72,632,851	F844L	probably benign	Het
Snx19	A	G	9: 30,428,616	E350G	possibly damaging	Het
Tecta	T	A	9: 42,367,228	T995S	probably benign	Het
Tmc3	T	G	7: 83,612,473	N586K	probably damaging	Het
Tmem107	T	A	11: 69,072,413		probably benign	Het
Tmem247	A	G	17: 86,918,561	Q51R	probably benign	Het
Tmpo	G	T	10: 91,164,038		probably benign	Het
Ubr5	T	A	15: 37,996,571	T1894S	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Xirp2	T	A	2: 67,517,124	H3236Q	probably benign	Het
Zfand4	G	A	6: 116,314,739	D545N	probably benign	Het
Zkscan3	G	T	13: 21,394,774	P155T	possibly damaging	Het

Other mutations in Blm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01531:Blm	APN	7	80474071	missense	probably damaging	1.00
IGL01658:Blm	APN	7	80463941	missense	probably damaging	0.98
IGL02048:Blm	APN	7	80502961	splice site	probably benign
IGL02060:Blm	APN	7	80514580	splice site	probably benign
IGL02063:Blm	APN	7	80509419	nonsense	probably null
IGL02102:Blm	APN	7	80469756	missense	probably damaging	1.00
IGL02420:Blm	APN	7	80496006	missense	probably damaging	1.00
IGL02452:Blm	APN	7	80503377	splice site	probably null
IGL02566:Blm	APN	7	80474196	missense	probably damaging	1.00
IGL03387:Blm	APN	7	80494147	missense	probably damaging	1.00
FR4304:Blm	UTSW	7	80463773	frame shift	probably null
FR4304:Blm	UTSW	7	80512919	small insertion	probably benign
FR4340:Blm	UTSW	7	80463767	unclassified	probably benign
FR4340:Blm	UTSW	7	80512907	small insertion	probably benign
FR4340:Blm	UTSW	7	80512910	small insertion	probably benign
FR4449:Blm	UTSW	7	80512908	small insertion	probably benign
FR4548:Blm	UTSW	7	80463769	frame shift	probably null
FR4589:Blm	UTSW	7	80463770	frame shift	probably null
FR4737:Blm	UTSW	7	80463771	frame shift	probably null
FR4737:Blm	UTSW	7	80463774	frame shift	probably null
FR4976:Blm	UTSW	7	80463767	unclassified	probably benign
FR4976:Blm	UTSW	7	80512907	small insertion	probably benign
R0194:Blm	UTSW	7	80464946	unclassified	probably benign
R0526:Blm	UTSW	7	80505893	nonsense	probably null
R0673:Blm	UTSW	7	80499751	critical splice donor site	probably null
R0972:Blm	UTSW	7	80513370	missense	probably benign
R0980:Blm	UTSW	7	80499958	splice site	probably null
R1120:Blm	UTSW	7	80481466	missense	probably damaging	1.00
R1301:Blm	UTSW	7	80455417	nonsense	probably null
R1769:Blm	UTSW	7	80513370	missense	probably benign
R1866:Blm	UTSW	7	80494114	missense	probably benign	0.08
R1874:Blm	UTSW	7	80497418	missense	probably damaging	1.00
R1966:Blm	UTSW	7	80513186	missense	possibly damaging	0.86
R1991:Blm	UTSW	7	80505949	splice site	probably null
R2013:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2014:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2015:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2016:Blm	UTSW	7	80505926	missense	probably benign	0.26
R2103:Blm	UTSW	7	80505949	splice site	probably null
R2161:Blm	UTSW	7	80481370	splice site	probably null
R2215:Blm	UTSW	7	80499847	missense	possibly damaging	0.69
R3689:Blm	UTSW	7	80513079	missense	possibly damaging	0.56
R4049:Blm	UTSW	7	80502862	missense	probably benign	0.04
R4155:Blm	UTSW	7	80512904	small deletion	probably benign
R4695:Blm	UTSW	7	80494228	missense	probably damaging	1.00
R4774:Blm	UTSW	7	80463848	missense	probably damaging	1.00
R4833:Blm	UTSW	7	80466826	missense	probably benign
R4835:Blm	UTSW	7	80509546	missense	probably benign	0.41
R4994:Blm	UTSW	7	80458825	missense	probably benign	0.00
R5039:Blm	UTSW	7	80505873	missense	possibly damaging	0.50
R5330:Blm	UTSW	7	80458936	missense	possibly damaging	0.73
R5375:Blm	UTSW	7	80513229	missense	probably benign	0.00
R5408:Blm	UTSW	7	80502622	missense	probably benign	0.01
R5574:Blm	UTSW	7	80499773	missense	probably damaging	1.00
R5606:Blm	UTSW	7	80460832	splice site	probably null
R5702:Blm	UTSW	7	80458927	missense	probably benign	0.13
R5809:Blm	UTSW	7	80464844	missense	probably damaging	1.00
R6114:Blm	UTSW	7	80513487	missense	probably damaging	1.00
R6157:Blm	UTSW	7	80512985	missense	probably benign	0.18
R6163:Blm	UTSW	7	80512904	small deletion	probably benign
R6254:Blm	UTSW	7	80480342	missense	probably benign	0.04
R6266:Blm	UTSW	7	80499940	missense	probably benign	0.03
R6364:Blm	UTSW	7	80494526	nonsense	probably null
R6446:Blm	UTSW	7	80512904	small deletion	probably benign
R6502:Blm	UTSW	7	80481475	missense	probably damaging	0.98
R6700:Blm	UTSW	7	80463850	missense	possibly damaging	0.91
R7002:Blm	UTSW	7	80469753	missense	probably benign	0.00
R7105:Blm	UTSW	7	80499768	missense	probably benign	0.44
R7320:Blm	UTSW	7	80455354	nonsense	probably null
R7465:Blm	UTSW	7	80513115	missense	probably benign	0.02
R7561:Blm	UTSW	7	80502528	missense	probably damaging	0.99
R8500:Blm	UTSW	7	80455284	missense	probably damaging	1.00
R8543:Blm	UTSW	7	80494216	missense	probably damaging	0.98
R8774-TAIL:Blm	UTSW	7	80512907	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512918	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512919	small insertion	probably benign
R8775-TAIL:Blm	UTSW	7	80512931	small insertion	probably benign
R8860:Blm	UTSW	7	80494528	missense	probably benign	0.30
R8928:Blm	UTSW	7	80512904	small deletion	probably benign
R9089:Blm	UTSW	7	80513119	missense	probably damaging	1.00
R9363:Blm	UTSW	7	80458915	missense	probably damaging	1.00
RF001:Blm	UTSW	7	80512903	small insertion	probably benign
RF001:Blm	UTSW	7	80512906	small insertion	probably benign
RF001:Blm	UTSW	7	80512927	small insertion	probably benign
RF002:Blm	UTSW	7	80512905	small insertion	probably benign
RF002:Blm	UTSW	7	80512927	small insertion	probably benign
RF007:Blm	UTSW	7	80512933	nonsense	probably null
RF016:Blm	UTSW	7	80512926	nonsense	probably null
RF018:Blm	UTSW	7	80512926	nonsense	probably null
RF027:Blm	UTSW	7	80512914	frame shift	probably null
RF028:Blm	UTSW	7	80512905	nonsense	probably null
RF031:Blm	UTSW	7	80512906	small insertion	probably benign
RF031:Blm	UTSW	7	80512923	small insertion	probably benign
RF032:Blm	UTSW	7	80512930	small insertion	probably benign
RF036:Blm	UTSW	7	80512914	nonsense	probably null
RF044:Blm	UTSW	7	80512930	small insertion	probably benign
RF053:Blm	UTSW	7	80512921	small insertion	probably benign
RF064:Blm	UTSW	7	80512923	nonsense	probably null
X0061:Blm	UTSW	7	80458850	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCTCAGGCAATGACTGCTGCTATG -3'
(R):5'- TTCTCACCAGCACCACTGTGAAAG -3'

Sequencing Primer
(F):5'- GCAATGACTGCTGCTATGCTATAC -3'
(R):5'- TCAGAGTAAACAAGCTGCTTCAG -3'

Posted On

2013-04-12