Incidental Mutation 'R1953:Slc22a18'
ID217477
Institutional Source Beutler Lab
Gene Symbol Slc22a18
Ensembl Gene ENSMUSG00000000154
Gene Namesolute carrier family 22 (organic cation transporter), member 18
Synonymsp45-BWR1A, Impt1, BWSCR1A, Orctl2, BWR1A, Slc22a1l, IMPT1, TSSC5
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1953 (G1)
Quality Score202
Status Not validated
Chromosome7
Chromosomal Location143473736-143499334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143476247 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 17 (T17I)
Ref Sequence ENSEMBL: ENSMUSP00000101537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052348] [ENSMUST00000105917] [ENSMUST00000141988] [ENSMUST00000145943] [ENSMUST00000150791]
Predicted Effect probably damaging
Transcript: ENSMUST00000052348
AA Change: T17I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056082
Gene: ENSMUSG00000000154
AA Change: T17I

DomainStartEndE-ValueType
Pfam:MFS_1 14 339 1.1e-31 PFAM
Pfam:MFS_1 229 410 5.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105917
AA Change: T17I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101537
Gene: ENSMUSG00000000154
AA Change: T17I

DomainStartEndE-ValueType
Pfam:MFS_1 14 337 7.8e-32 PFAM
Pfam:MFS_3 66 346 6.5e-9 PFAM
Pfam:MFS_1 229 410 3.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141988
AA Change: T17I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000145943
AA Change: T17I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115345
Gene: ENSMUSG00000000154
AA Change: T17I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146983
AA Change: P99S
Predicted Effect probably damaging
Transcript: ENSMUST00000150791
AA Change: T17I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.5082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is imprinted, with preferential expression from the maternal allele. Mutations in this gene have been found in Wilms' tumor and lung cancer. This protein may act as a transporter of organic cations, and have a role in the transport of chloroquine and quinidine-related compounds in kidney. Several alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Slc22a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Slc22a18 APN 7 143499100 missense probably damaging 1.00
IGL01888:Slc22a18 APN 7 143479316 missense probably damaging 1.00
IGL02458:Slc22a18 APN 7 143492837 splice site probably benign
IGL02626:Slc22a18 APN 7 143499100 missense probably damaging 1.00
PIT4810001:Slc22a18 UTSW 7 143492931 missense probably benign 0.00
R0294:Slc22a18 UTSW 7 143492841 critical splice acceptor site probably null
R0571:Slc22a18 UTSW 7 143491861 splice site probably benign
R1951:Slc22a18 UTSW 7 143476247 missense probably damaging 1.00
R2352:Slc22a18 UTSW 7 143497415 missense probably benign 0.02
R3900:Slc22a18 UTSW 7 143479770 missense probably damaging 1.00
R5317:Slc22a18 UTSW 7 143499159 missense probably damaging 1.00
R5428:Slc22a18 UTSW 7 143479345 missense probably damaging 1.00
R7672:Slc22a18 UTSW 7 143490820 missense probably damaging 1.00
R7684:Slc22a18 UTSW 7 143490840 missense probably benign 0.00
R7688:Slc22a18 UTSW 7 143479823 missense probably damaging 1.00
R8130:Slc22a18 UTSW 7 143499174 missense probably damaging 1.00
R8443:Slc22a18 UTSW 7 143497386 missense probably damaging 0.96
Z1177:Slc22a18 UTSW 7 143497042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTTGAAGGTCGAGGTAGC -3'
(R):5'- ATCAATGGCCCCAGTTCCTAG -3'

Sequencing Primer
(F):5'- TGAGCTCCACAGTCAGCC -3'
(R):5'- GTTCCTAGGATCCTTAATGTATCCAG -3'
Posted On2014-08-01