Mutagenetix > Incidental Mutations

Incidental Mutation 'R1953:Adcy1'

217494

Institutional Source

Beutler Lab

Gene Symbol

Adcy1

Ensembl Gene

ENSMUSG00000020431

Gene Name

adenylate cyclase 1

Synonyms

I-AC, D11Bwg1392e, AC1

MMRRC Submission

039967-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7063489-7178506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7078991 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 247 (N247S)

Ref Sequence

ENSEMBL: ENSMUSP00000020706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020706]

Predicted Effect

probably benign
Transcript: ENSMUST00000020706
AA Change: N247S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431
AA Change: N247S

Domain	Start	End	E-Value	Type
low complexity region	2	36	N/A	INTRINSIC
low complexity region	58	90	N/A	INTRINSIC
low complexity region	112	135	N/A	INTRINSIC
CYCc	257	455	2.05e-80	SMART
transmembrane domain	608	630	N/A	INTRINSIC
transmembrane domain	634	656	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
CYCc	827	1038	1.71e-50	SMART
low complexity region	1090	1104	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	T	16: 38,827,913	T278K	possibly damaging	Het
5730455P16Rik	A	T	11: 80,377,946	D12E	probably damaging	Het
Abca15	C	T	7: 120,361,432	R706C	probably damaging	Het
Actr1a	G	A	19: 46,380,948	S209F	probably benign	Het
Anapc4	T	C	5: 52,839,688	L101S	probably damaging	Het
Asap3	C	T	4: 136,227,456	R60*	probably null	Het
Ascc3	T	C	10: 50,845,630	S2060P	probably benign	Het
Atp9b	G	A	18: 80,754,307	T851I	possibly damaging	Het
Borcs5	A	G	6: 134,710,267	H196R	unknown	Het
Bpifb9b	A	C	2: 154,311,314	D100A	probably damaging	Het
Cant1	G	C	11: 118,408,783	P247A	probably damaging	Het
Capza3	A	T	6: 140,042,568	I298L	possibly damaging	Het
Cdh10	T	C	15: 18,966,911		probably null	Het
Celsr3	T	C	9: 108,843,182	V2551A	probably benign	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cmtr2	T	C	8: 110,221,919	L287P	probably damaging	Het
Crebbp	G	A	16: 4,179,449	T257I	probably benign	Het
Crispld2	G	A	8: 120,015,296	V128M	probably damaging	Het
Crnkl1	G	A	2: 145,928,200	A241V	probably damaging	Het
Dmd	T	A	X: 83,830,517	I1342N	probably damaging	Het
Dnah10	A	G	5: 124,782,268	T2043A	probably benign	Het
Dscaml1	C	T	9: 45,670,224	T447I	probably benign	Het
Eif2ak3	A	G	6: 70,892,554	T742A	probably benign	Het
Farp1	A	G	14: 121,255,482	T499A	probably benign	Het
Fcgr1	G	A	3: 96,287,070	T167I	probably damaging	Het
Fgd5	C	A	6: 92,024,630	H935Q	probably benign	Het
Fhl4	A	T	10: 85,098,307	D203E	probably benign	Het
Gapt	T	G	13: 110,353,806	T108P	probably damaging	Het
Gm12800	T	C	4: 101,910,115	I187T	probably benign	Het
Gm13762	G	A	2: 88,973,880	Q4*	probably null	Het
Gpt2	A	G	8: 85,521,384	T419A	probably benign	Het
Gucy2c	A	G	6: 136,704,293	V907A	probably damaging	Het
Hmbs	T	C	9: 44,337,444	D211G	probably damaging	Het
Irx5	A	G	8: 92,359,810	N174D	probably damaging	Het
Itfg1	A	G	8: 85,831,231	V170A	probably benign	Het
Itga2b	T	A	11: 102,458,183	T732S	probably benign	Het
Klhl3	A	G	13: 58,011,208	Y546H	probably damaging	Het
Lama5	G	A	2: 180,190,747	H1670Y	possibly damaging	Het
Mlst8	AT	ATT	17: 24,478,013		probably null	Het
Nbeal1	T	C	1: 60,234,840	V409A	probably damaging	Het
Nlgn1	T	A	3: 25,436,300	D421V	probably damaging	Het
Nlrp10	T	C	7: 108,925,118	D385G	probably benign	Het
Nr2e3	T	A	9: 59,949,796	D30V	probably benign	Het
Nyap1	A	G	5: 137,735,032	S580P	probably benign	Het
Olfr1259	A	G	2: 89,943,923	L64P	probably damaging	Het
Olfr1509	T	A	14: 52,450,887	V158E	probably benign	Het
Pex1	A	G	5: 3,630,038	H952R	probably damaging	Het
Plin4	T	A	17: 56,103,849	I1061F	possibly damaging	Het
Pnkp	C	A	7: 44,862,602	R517S	probably benign	Het
Polr2e	T	A	10: 80,038,554	E39D	probably benign	Het
Prokr1	T	C	6: 87,588,593	Y90C	probably benign	Het
Ptprm	A	T	17: 66,940,580	S587T	probably benign	Het
Rere	G	A	4: 150,616,837	E1225K	probably damaging	Het
Rsl24d1	G	T	9: 73,114,614		probably benign	Het
Selp	A	G	1: 164,126,512	N127S	probably benign	Het
Slc22a18	C	T	7: 143,476,247	T17I	probably damaging	Het
Smad2	A	G	18: 76,262,705	T72A	possibly damaging	Het
Snx29	G	A	16: 11,399,783	W149*	probably null	Het
Stk31	G	T	6: 49,446,478		probably null	Het
Sult1e1	T	G	5: 87,587,671		probably null	Het
Syngap1	G	A	17: 26,944,687	R41H	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,398		probably null	Het
Tie1	A	T	4: 118,472,790		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Usp47	T	A	7: 112,092,876	D848E	probably benign	Het
Vmn1r72	A	G	7: 11,669,804	L239P	probably damaging	Het
Vmn2r124	T	C	17: 18,062,860	I272T	probably benign	Het
Vwa1	C	T	4: 155,773,114	V76M	probably damaging	Het
Xrn1	G	T	9: 96,024,221		probably null	Het
Zfp667	G	T	7: 6,305,088	V252F	probably benign	Het
Zranb3	A	T	1: 127,999,399	V343D	probably damaging	Het

Other mutations in Adcy1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Adcy1	APN	11	7137385	missense	probably damaging	0.99
IGL01325:Adcy1	APN	11	7064102	missense	possibly damaging	0.58
IGL01531:Adcy1	APN	11	7169414	missense	possibly damaging	0.95
IGL01585:Adcy1	APN	11	7167143	missense	probably damaging	1.00
IGL01932:Adcy1	APN	11	7100565	splice site	probably benign
IGL01945:Adcy1	APN	11	7161891	missense	probably damaging	1.00
IGL02532:Adcy1	APN	11	7144737	missense	probably benign	0.26
IGL02649:Adcy1	APN	11	7167156	missense	probably damaging	1.00
IGL02658:Adcy1	APN	11	7138279	splice site	probably benign
IGL02813:Adcy1	APN	11	7146591	missense	possibly damaging	0.83
IGL02931:Adcy1	APN	11	7079012	missense	probably benign	0.19
IGL03116:Adcy1	APN	11	7150071	missense	probably benign
IGL03119:Adcy1	APN	11	7109051	missense	probably damaging	1.00
IGL03214:Adcy1	APN	11	7167054	splice site	probably benign
PIT4431001:Adcy1	UTSW	11	7064089	missense	possibly damaging	0.93
PIT4520001:Adcy1	UTSW	11	7167133	missense	probably damaging	1.00
R0032:Adcy1	UTSW	11	7144729	missense	possibly damaging	0.93
R0032:Adcy1	UTSW	11	7144729	missense	possibly damaging	0.93
R0080:Adcy1	UTSW	11	7149497	splice site	probably benign
R0082:Adcy1	UTSW	11	7149497	splice site	probably benign
R0238:Adcy1	UTSW	11	7139162	missense	possibly damaging	0.80
R0238:Adcy1	UTSW	11	7139162	missense	possibly damaging	0.80
R0312:Adcy1	UTSW	11	7149538	missense	probably benign	0.08
R0569:Adcy1	UTSW	11	7146514	missense	probably benign	0.34
R1055:Adcy1	UTSW	11	7109075	missense	probably damaging	1.00
R1144:Adcy1	UTSW	11	7137400	missense	probably damaging	1.00
R1179:Adcy1	UTSW	11	7167054	splice site	probably null
R1245:Adcy1	UTSW	11	7169410	splice site	probably benign
R1467:Adcy1	UTSW	11	7138396	missense	probably damaging	0.97
R1467:Adcy1	UTSW	11	7138396	missense	probably damaging	0.97
R1823:Adcy1	UTSW	11	7161312	missense	probably benign	0.23
R1957:Adcy1	UTSW	11	7161945	missense	probably benign	0.00
R2029:Adcy1	UTSW	11	7139142	missense	probably benign	0.10
R2051:Adcy1	UTSW	11	7161885	nonsense	probably null
R2483:Adcy1	UTSW	11	7130348	missense	probably benign	0.01
R3108:Adcy1	UTSW	11	7169453	missense	probably damaging	1.00
R3623:Adcy1	UTSW	11	7130348	missense	probably benign	0.01
R3624:Adcy1	UTSW	11	7130348	missense	probably benign	0.01
R4082:Adcy1	UTSW	11	7064117	missense	probably damaging	1.00
R4159:Adcy1	UTSW	11	7063889	missense	probably damaging	1.00
R4470:Adcy1	UTSW	11	7144804	missense	probably benign	0.17
R4472:Adcy1	UTSW	11	7130369	missense	probably damaging	1.00
R4951:Adcy1	UTSW	11	7138336	missense	possibly damaging	0.83
R4997:Adcy1	UTSW	11	7161298	missense	probably benign	0.25
R5237:Adcy1	UTSW	11	7149553	missense	probably benign	0.00
R5288:Adcy1	UTSW	11	7161351	missense	probably benign	0.01
R5304:Adcy1	UTSW	11	7064198	missense	probably benign	0.00
R5341:Adcy1	UTSW	11	7130375	missense	probably damaging	0.99
R5379:Adcy1	UTSW	11	7146532	missense	probably damaging	1.00
R5592:Adcy1	UTSW	11	7139088	nonsense	probably null
R5677:Adcy1	UTSW	11	7161914	missense	probably damaging	1.00
R5680:Adcy1	UTSW	11	7109020	missense	probably damaging	1.00
R5753:Adcy1	UTSW	11	7130300	missense	probably damaging	1.00
R5888:Adcy1	UTSW	11	7139095	missense	possibly damaging	0.66
R5943:Adcy1	UTSW	11	7161337	missense	probably damaging	1.00
R6435:Adcy1	UTSW	11	7161367	missense	possibly damaging	0.60
R6931:Adcy1	UTSW	11	7150884	missense	possibly damaging	0.81
R6998:Adcy1	UTSW	11	7079026	missense	probably damaging	1.00
R7368:Adcy1	UTSW	11	7144765	missense	probably damaging	1.00
R7378:Adcy1	UTSW	11	7169543	missense	possibly damaging	0.56
R7393:Adcy1	UTSW	11	7137381	missense	probably damaging	1.00
R7500:Adcy1	UTSW	11	7144762	missense	probably damaging	1.00
R7529:Adcy1	UTSW	11	7139157	missense	probably damaging	0.98
X0027:Adcy1	UTSW	11	7161930	missense	possibly damaging	0.47
Z1088:Adcy1	UTSW	11	7150019	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TGCTTAGAGATCCCTGGGTG -3'
(R):5'- GCCATTAAAGCAGACTGAGGC -3'

Sequencing Primer
(F):5'- ATCCCTGGGTGGCTGTGAG -3'
(R):5'- CCATTAAAGCAGACTGAGGCTCAAG -3'

Posted On

2014-08-01