Incidental Mutation 'R1953:Olfr1509'
ID217505
Institutional Source Beutler Lab
Gene Symbol Olfr1509
Ensembl Gene ENSMUSG00000035626
Gene Nameolfactory receptor 1509
SynonymsMOR244-3, MOR83, GA_x6K02T2RJGY-534312-533386
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52442990-52452574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52450887 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 158 (V158E)
Ref Sequence ENSEMBL: ENSMUSP00000150016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045066] [ENSMUST00000205900] [ENSMUST00000206100] [ENSMUST00000206437] [ENSMUST00000206718] [ENSMUST00000215030]
Predicted Effect probably benign
Transcript: ENSMUST00000045066
AA Change: V158E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046688
Gene: ENSMUSG00000035626
AA Change: V158E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.3e-6 PFAM
Pfam:7tm_1 41 287 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205900
AA Change: V158E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000206100
AA Change: V158E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000206437
Predicted Effect probably benign
Transcript: ENSMUST00000206718
Predicted Effect probably benign
Transcript: ENSMUST00000215030
AA Change: V158E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Olfr1509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1509 APN 14 52451027 missense probably benign 0.00
IGL01694:Olfr1509 APN 14 52450584 missense probably benign
IGL02656:Olfr1509 APN 14 52450709 missense possibly damaging 0.60
R0244:Olfr1509 UTSW 14 52450512 missense probably benign 0.00
R1249:Olfr1509 UTSW 14 52450522 missense probably benign
R1601:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
R1717:Olfr1509 UTSW 14 52450839 missense probably benign 0.00
R4689:Olfr1509 UTSW 14 52451214 missense probably benign
R4943:Olfr1509 UTSW 14 52450594 nonsense probably null
R6223:Olfr1509 UTSW 14 52450679 missense probably benign 0.00
R6516:Olfr1509 UTSW 14 52451129 missense probably damaging 1.00
R7323:Olfr1509 UTSW 14 52451213 missense probably benign 0.00
R7507:Olfr1509 UTSW 14 52450473 missense probably benign 0.00
R7674:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
Z1088:Olfr1509 UTSW 14 52451209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTGCATTGCACAGCTCTTC -3'
(R):5'- TTCTGCAGACTGTTTTCGAAGAG -3'

Sequencing Primer
(F):5'- GCATTGCACAGCTCTTCTTCCTAC -3'
(R):5'- CTGTGTAAGAAGTGACCAAGGC -3'
Posted On2014-08-01