Incidental Mutation 'R1953:Cdh10'
ID217507
Institutional Source Beutler Lab
Gene Symbol Cdh10
Ensembl Gene ENSMUSG00000022321
Gene Namecadherin 10
SynonymsT2-cadherin, C030003B10Rik, C030011H18Rik, A830016G23Rik
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location18818947-19014236 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 18966911 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040562] [ENSMUST00000166873] [ENSMUST00000176146]
Predicted Effect probably null
Transcript: ENSMUST00000040562
SMART Domains Protein: ENSMUSP00000042199
Gene: ENSMUSG00000022321

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 635 782 9.2e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166873
SMART Domains Protein: ENSMUSP00000128782
Gene: ENSMUSG00000022321

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 637 783 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176146
SMART Domains Protein: ENSMUSP00000135546
Gene: ENSMUSG00000022321

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176593
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in the blood-brain barrier and retinal endothelia suggesting a role in the development and maintenance of brain barrier. Alternative splicing results in multiple transcript variants. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Cdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Cdh10 APN 15 19013263 missense probably damaging 1.00
IGL00540:Cdh10 APN 15 18963995 missense probably damaging 1.00
IGL00769:Cdh10 APN 15 18985099 missense possibly damaging 0.63
IGL00837:Cdh10 APN 15 19013404 missense probably benign
IGL01307:Cdh10 APN 15 18899800 missense probably benign 0.34
IGL01509:Cdh10 APN 15 18986798 missense possibly damaging 0.70
IGL01561:Cdh10 APN 15 18999926 missense possibly damaging 0.52
IGL01743:Cdh10 APN 15 18986769 missense probably benign 0.06
IGL02065:Cdh10 APN 15 19013256 missense probably damaging 1.00
IGL02083:Cdh10 APN 15 18986889 missense possibly damaging 0.79
IGL02238:Cdh10 APN 15 19013519 missense probably damaging 1.00
IGL02838:Cdh10 APN 15 18899763 missense probably damaging 1.00
IGL03397:Cdh10 APN 15 18964028 missense probably damaging 1.00
R0423:Cdh10 UTSW 15 18986879 missense probably benign 0.00
R0828:Cdh10 UTSW 15 18986751 missense possibly damaging 0.52
R1488:Cdh10 UTSW 15 19013263 missense probably damaging 1.00
R1563:Cdh10 UTSW 15 18986767 nonsense probably null
R1674:Cdh10 UTSW 15 18985066 missense probably benign 0.11
R1674:Cdh10 UTSW 15 19013330 missense probably damaging 1.00
R1737:Cdh10 UTSW 15 18964063 missense probably damaging 1.00
R1819:Cdh10 UTSW 15 18991965 nonsense probably null
R1865:Cdh10 UTSW 15 18899604 missense probably benign 0.01
R2439:Cdh10 UTSW 15 19013398 missense probably damaging 1.00
R3944:Cdh10 UTSW 15 18964249 missense probably benign
R4320:Cdh10 UTSW 15 18985165 missense probably benign 0.03
R4330:Cdh10 UTSW 15 18999959 missense probably damaging 1.00
R4765:Cdh10 UTSW 15 19013278 missense probably damaging 0.98
R4831:Cdh10 UTSW 15 19013578 missense probably benign 0.10
R5102:Cdh10 UTSW 15 18986885 missense probably benign 0.05
R5166:Cdh10 UTSW 15 19013360 missense probably damaging 0.99
R5217:Cdh10 UTSW 15 18966022 missense probably damaging 0.98
R5843:Cdh10 UTSW 15 18985200 missense possibly damaging 0.68
R5902:Cdh10 UTSW 15 18985255 critical splice donor site probably null
R6263:Cdh10 UTSW 15 18964068 missense possibly damaging 0.86
R6636:Cdh10 UTSW 15 18985173 missense probably damaging 0.99
R6770:Cdh10 UTSW 15 18985222 missense probably benign 0.09
R7046:Cdh10 UTSW 15 19013201 missense probably damaging 0.98
R7362:Cdh10 UTSW 15 18899694 missense probably benign
R7491:Cdh10 UTSW 15 19013359 missense probably damaging 0.99
R7921:Cdh10 UTSW 15 18991956 missense probably damaging 1.00
R7937:Cdh10 UTSW 15 18964249 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTACCACACAGTGAGATGACC -3'
(R):5'- GGAGTAGTTAAGATTCAGAGTCCCC -3'

Sequencing Primer
(F):5'- CACAGTGAGATGACCCAGCATTTG -3'
(R):5'- CCCCAACTCTGTAAGAGA -3'
Posted On2014-08-01