Incidental Mutation 'R1953:Ptprm'
ID217515
Institutional Source Beutler Lab
Gene Symbol Ptprm
Ensembl Gene ENSMUSG00000033278
Gene Nameprotein tyrosine phosphatase, receptor type, M
SynonymsRPTPmu
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location66666947-67354457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66940580 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 587 (S587T)
Ref Sequence ENSEMBL: ENSMUSP00000045603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091]
Predicted Effect probably benign
Transcript: ENSMUST00000037974
AA Change: S587T

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: S587T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
MAM 22 184 2.81e-73 SMART
IG 191 279 2.1e-6 SMART
FN3 281 364 6.35e-4 SMART
FN3 380 468 2.81e-5 SMART
FN3 482 572 3.7e-5 SMART
transmembrane domain 743 764 N/A INTRINSIC
low complexity region 765 774 N/A INTRINSIC
PTPc 899 1156 5.26e-135 SMART
PTPc 1185 1450 9.46e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223982
AA Change: S587T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224091
AA Change: S587T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225688
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Ptprm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Ptprm APN 17 66817972 missense probably damaging 1.00
IGL01128:Ptprm APN 17 67042101 missense probably damaging 1.00
IGL01509:Ptprm APN 17 66762213 missense possibly damaging 0.95
IGL01785:Ptprm APN 17 66685623 missense probably damaging 1.00
IGL01912:Ptprm APN 17 67046118 missense probably benign 0.13
IGL01929:Ptprm APN 17 66690549 missense probably damaging 1.00
IGL01937:Ptprm APN 17 67046163 splice site probably benign
IGL01939:Ptprm APN 17 67063163 splice site probably benign
IGL02053:Ptprm APN 17 66693841 missense probably damaging 1.00
IGL02203:Ptprm APN 17 66953123 missense probably damaging 1.00
IGL02468:Ptprm APN 17 66814509 missense probably benign 0.02
IGL02500:Ptprm APN 17 66920048 missense probably damaging 0.99
IGL02542:Ptprm APN 17 66920150 missense probably benign
Becalming UTSW 17 66944332 splice site probably null
Pacifying UTSW 17 66683408 missense possibly damaging 0.74
R0674:Ptprm UTSW 17 67191341 missense possibly damaging 0.52
R0709:Ptprm UTSW 17 66944332 splice site probably null
R1054:Ptprm UTSW 17 67042318 missense probably damaging 1.00
R1522:Ptprm UTSW 17 66693871 missense possibly damaging 0.91
R1561:Ptprm UTSW 17 66940541 missense probably damaging 1.00
R1726:Ptprm UTSW 17 67042327 missense probably damaging 1.00
R1744:Ptprm UTSW 17 66689366 missense probably damaging 1.00
R1873:Ptprm UTSW 17 66688355 missense probably damaging 1.00
R1951:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1952:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1993:Ptprm UTSW 17 66747160 missense probably damaging 1.00
R2017:Ptprm UTSW 17 66957153 splice site probably null
R2266:Ptprm UTSW 17 66725851 splice site probably null
R2417:Ptprm UTSW 17 66944326 missense probably damaging 0.97
R2511:Ptprm UTSW 17 66693778 missense probably damaging 1.00
R3726:Ptprm UTSW 17 66956860 missense possibly damaging 0.91
R3824:Ptprm UTSW 17 66809575 missense probably benign 0.40
R4057:Ptprm UTSW 17 67075663 missense possibly damaging 0.93
R4113:Ptprm UTSW 17 66725813 missense probably damaging 1.00
R4559:Ptprm UTSW 17 66683408 missense possibly damaging 0.74
R4598:Ptprm UTSW 17 67095497 missense probably benign 0.00
R4742:Ptprm UTSW 17 66744751 nonsense probably null
R4974:Ptprm UTSW 17 66678067 missense probably benign 0.01
R5157:Ptprm UTSW 17 66957097 missense probably benign 0.09
R5433:Ptprm UTSW 17 66693473 missense probably damaging 1.00
R5509:Ptprm UTSW 17 66689358 missense probably damaging 1.00
R5586:Ptprm UTSW 17 66920196 missense probably damaging 1.00
R5820:Ptprm UTSW 17 66689465 missense probably damaging 1.00
R5867:Ptprm UTSW 17 67045981 splice site probably null
R6044:Ptprm UTSW 17 66693862 missense probably damaging 1.00
R6229:Ptprm UTSW 17 66688300 missense probably damaging 1.00
R6615:Ptprm UTSW 17 67353956 critical splice donor site probably null
R6969:Ptprm UTSW 17 66912418 missense possibly damaging 0.63
R7135:Ptprm UTSW 17 66944288 missense possibly damaging 0.93
R7161:Ptprm UTSW 17 66809627 missense probably benign 0.21
R7410:Ptprm UTSW 17 66693566 missense probably damaging 0.99
R7476:Ptprm UTSW 17 66725791 missense probably benign 0.01
R7789:Ptprm UTSW 17 67095539 missense probably damaging 1.00
R8027:Ptprm UTSW 17 66944205 missense probably damaging 1.00
R8089:Ptprm UTSW 17 66683488 missense possibly damaging 0.63
R8442:Ptprm UTSW 17 66944317 missense possibly damaging 0.70
R8476:Ptprm UTSW 17 66944322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGTATGACCCTTTTGC -3'
(R):5'- AACCCAAGCTGTGCTCTTTC -3'

Sequencing Primer
(F):5'- GCCAGTATGACCCTTTTGCTGTTG -3'
(R):5'- AAGCTGTGCTCTTTCTCTGTTTC -3'
Posted On2014-08-01