Incidental Mutation 'R1953:Atp9b'
ID217518
Institutional Source Beutler Lab
Gene Symbol Atp9b
Ensembl Gene ENSMUSG00000024566
Gene NameATPase, class II, type 9B
SynonymsIIb
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80734141-80934058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80754307 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 851 (T851I)
Ref Sequence ENSEMBL: ENSMUSP00000153157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091790] [ENSMUST00000225235] [ENSMUST00000225980]
Predicted Effect probably benign
Transcript: ENSMUST00000091790
AA Change: T851I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089394
Gene: ENSMUSG00000024566
AA Change: T851I

DomainStartEndE-ValueType
low complexity region 11 39 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 110 181 5.3e-21 PFAM
Pfam:E1-E2_ATPase 186 444 9.1e-15 PFAM
Pfam:Hydrolase 463 885 2.7e-13 PFAM
Pfam:HAD 464 882 4.8e-14 PFAM
Pfam:Cation_ATPase 563 664 3.7e-7 PFAM
Pfam:PhoLip_ATPase_C 899 1128 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224283
Predicted Effect probably benign
Transcript: ENSMUST00000225092
Predicted Effect probably benign
Transcript: ENSMUST00000225218
Predicted Effect probably benign
Transcript: ENSMUST00000225235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225692
Predicted Effect possibly damaging
Transcript: ENSMUST00000225980
AA Change: T851I

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Atp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Atp9b APN 18 80917888 intron probably benign
IGL00769:Atp9b APN 18 80912853 missense probably benign 0.08
IGL00851:Atp9b APN 18 80765910 missense probably damaging 1.00
IGL01529:Atp9b APN 18 80844611 intron probably benign
IGL01637:Atp9b APN 18 80756455 missense probably benign 0.06
IGL01973:Atp9b APN 18 80758303 missense probably benign 0.02
IGL02082:Atp9b APN 18 80891930 intron probably benign
IGL02560:Atp9b APN 18 80762198 missense probably benign 0.23
IGL02981:Atp9b APN 18 80754289 missense possibly damaging 0.93
IGL03151:Atp9b APN 18 80776850 missense probably benign 0.28
IGL03304:Atp9b APN 18 80917877 missense probably damaging 1.00
IGL03348:Atp9b APN 18 80836422 missense possibly damaging 0.88
R0056:Atp9b UTSW 18 80765803 missense probably damaging 0.99
R0355:Atp9b UTSW 18 80909585 intron probably benign
R0366:Atp9b UTSW 18 80762102 missense probably damaging 1.00
R0557:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R0612:Atp9b UTSW 18 80753956 missense possibly damaging 0.81
R1099:Atp9b UTSW 18 80858626 missense probably damaging 1.00
R1126:Atp9b UTSW 18 80778954 missense probably damaging 1.00
R1499:Atp9b UTSW 18 80762138 missense probably damaging 0.99
R1499:Atp9b UTSW 18 80778907 missense probably benign 0.02
R1764:Atp9b UTSW 18 80909591 critical splice donor site probably null
R1780:Atp9b UTSW 18 80776897 nonsense probably null
R1782:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R1835:Atp9b UTSW 18 80778883 missense probably benign 0.00
R1859:Atp9b UTSW 18 80749920 missense possibly damaging 0.95
R2140:Atp9b UTSW 18 80736087 missense probably damaging 0.99
R2191:Atp9b UTSW 18 80753051 missense probably damaging 1.00
R4118:Atp9b UTSW 18 80749829 missense possibly damaging 0.83
R4605:Atp9b UTSW 18 80753149 critical splice acceptor site probably null
R4654:Atp9b UTSW 18 80891878 missense probably benign 0.00
R4767:Atp9b UTSW 18 80753070 missense probably damaging 1.00
R4775:Atp9b UTSW 18 80765769 critical splice donor site probably null
R4936:Atp9b UTSW 18 80736093 missense possibly damaging 0.58
R5096:Atp9b UTSW 18 80762184 missense probably benign 0.39
R5279:Atp9b UTSW 18 80912858 missense probably damaging 0.98
R5394:Atp9b UTSW 18 80776837 missense probably benign 0.16
R5774:Atp9b UTSW 18 80933932 missense probably damaging 0.96
R5877:Atp9b UTSW 18 80752789 missense probably benign
R6080:Atp9b UTSW 18 80738808 missense probably benign 0.03
R6170:Atp9b UTSW 18 80877347 missense probably benign 0.16
R6250:Atp9b UTSW 18 80756521 missense probably benign 0.01
R6340:Atp9b UTSW 18 80778900 missense probably benign 0.38
R6498:Atp9b UTSW 18 80777015 missense probably benign 0.03
R6620:Atp9b UTSW 18 80808687 nonsense probably null
R6632:Atp9b UTSW 18 80808649 missense probably damaging 1.00
R6665:Atp9b UTSW 18 80917735 missense probably benign 0.26
R6821:Atp9b UTSW 18 80847248 missense probably damaging 1.00
R6927:Atp9b UTSW 18 80891857 missense possibly damaging 0.63
R6977:Atp9b UTSW 18 80753102 missense probably damaging 1.00
R7133:Atp9b UTSW 18 80909656 missense
R7188:Atp9b UTSW 18 80917826 missense
R7396:Atp9b UTSW 18 80736842 missense
R7432:Atp9b UTSW 18 80765841 missense
Predicted Primers PCR Primer
(F):5'- GGATCATGCTCACGTCATTCCC -3'
(R):5'- TACTTGAGGAAGGCTGAAGC -3'

Sequencing Primer
(F):5'- TCGCCTGAGAGGTACCAAG -3'
(R):5'- AGGCTGAAGCTTTCTTACAACTCTG -3'
Posted On2014-08-01