Incidental Mutation 'R1953:Dmd'
ID217521
Institutional Source Beutler Lab
Gene Symbol Dmd
Ensembl Gene ENSMUSG00000045103
Gene Namedystrophin, muscular dystrophy
SynonymsDp71, mdx, X-linked muscular dystrophy, Dp427, Duchenne muscular dystrophy, pke, dys
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R1953 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location82948870-85206141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83830517 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1342 (I1342N)
Ref Sequence ENSEMBL: ENSMUSP00000109633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114000]
Predicted Effect probably damaging
Transcript: ENSMUST00000114000
AA Change: I1342N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109633
Gene: ENSMUSG00000045103
AA Change: I1342N

DomainStartEndE-ValueType
CH 17 117 5.94e-27 SMART
CH 136 235 3.83e-21 SMART
SPEC 344 448 7.39e-17 SMART
SPEC 453 557 6.49e-13 SMART
SPEC 564 668 9.73e-2 SMART
low complexity region 672 695 N/A INTRINSIC
SPEC 724 829 9.18e-13 SMART
SPEC 835 935 2.28e-1 SMART
SPEC 944 1046 9.34e-2 SMART
SPEC 1053 1155 7.99e-13 SMART
SPEC 1162 1264 7.52e-9 SMART
SPEC 1271 1368 5.53e-7 SMART
SPEC 1470 1569 7.29e-7 SMART
SPEC 1576 1677 8.29e-1 SMART
SPEC 1684 1781 1.82e-1 SMART
SPEC 1786 1875 3.48e0 SMART
SPEC 1882 1972 6.69e-2 SMART
SPEC 2000 2102 1.45e0 SMART
SPEC 2109 2209 6.15e-14 SMART
SPEC 2216 2317 8.9e-11 SMART
low complexity region 2325 2337 N/A INTRINSIC
low complexity region 2432 2444 N/A INTRINSIC
SPEC 2466 2569 1.65e-14 SMART
SPEC 2576 2678 1.2e-7 SMART
SPEC 2685 2794 9.84e-13 SMART
SPEC 2801 2923 8.38e-7 SMART
SPEC 2930 3032 1.21e-12 SMART
WW 3049 3081 1.36e-10 SMART
Pfam:EF-hand_2 3082 3200 1.7e-42 PFAM
Pfam:EF-hand_3 3204 3295 6.6e-41 PFAM
ZnF_ZZ 3300 3345 7.39e-18 SMART
coiled coil region 3488 3598 N/A INTRINSIC
Meta Mutation Damage Score 0.3254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers in skeletal and cardiac muscles. The encoded protein, dystrophin, is part of the dystrophin-glycoprotein complex, which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. This protein is required for proper development and organization of myofibers as contractile units in striated muscles. Mutations in the human gene cause Duchenne and Becker Muscular Dystrophies and a form of heart disease called DMD-associated dilated cardiomyopathy. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene cause muscular dystrophy. Phenotypic variation has been observed in different backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Klhl3 A G 13: 58,011,208 Y546H probably damaging Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Dmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Dmd APN X 83908372 splice site probably null
IGL00823:Dmd APN X 84425813 splice site probably null
IGL01160:Dmd APN X 83924961 missense probably damaging 1.00
IGL01285:Dmd APN X 85109984 nonsense probably null
IGL01294:Dmd APN X 84431998 splice site probably null
IGL02426:Dmd APN X 84848736 missense probably damaging 1.00
IGL02610:Dmd APN X 83664156 missense probably damaging 1.00
IGL02887:Dmd APN X 83878504 missense probably benign 0.44
IGL03268:Dmd APN X 83806208 missense probably damaging 0.98
IGL03301:Dmd APN X 83908514 missense probably damaging 1.00
R0480:Dmd UTSW X 84425738 missense probably benign 0.00
R0714:Dmd UTSW X 84309897 missense probably benign 0.00
R1296:Dmd UTSW X 83878520 missense probably damaging 1.00
R1448:Dmd UTSW X 84848700 missense probably damaging 0.97
R1678:Dmd UTSW X 84974762 missense probably benign 0.43
R1714:Dmd UTSW X 83964750 missense probably benign 0.17
R1951:Dmd UTSW X 83830517 missense probably damaging 1.00
R1952:Dmd UTSW X 83830517 missense probably damaging 1.00
R1955:Dmd UTSW X 83878557 missense probably benign 0.10
R2072:Dmd UTSW X 84312483 missense probably benign 0.33
R2073:Dmd UTSW X 84312483 missense probably benign 0.33
R2074:Dmd UTSW X 84312483 missense probably benign 0.33
R2075:Dmd UTSW X 84312483 missense probably benign 0.33
R2118:Dmd UTSW X 84312483 missense probably benign 0.33
R2119:Dmd UTSW X 84312483 missense probably benign 0.33
R2120:Dmd UTSW X 84312483 missense probably benign 0.33
R2122:Dmd UTSW X 84312483 missense probably benign 0.33
R4398:Dmd UTSW X 83722018 missense probably benign 0.01
X0025:Dmd UTSW X 84647194 missense probably benign
Z1088:Dmd UTSW X 83878495 missense possibly damaging 0.67
Z1088:Dmd UTSW X 84575760 missense probably benign 0.05
Z1176:Dmd UTSW X 83627286 missense probably damaging 1.00
Z1176:Dmd UTSW X 83878484 missense possibly damaging 0.90
Z1177:Dmd UTSW X 83627271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGAAAATGCAGAGATAACCC -3'
(R):5'- TTCACTTACTGCTGTAAAATCAGAC -3'

Sequencing Primer
(F):5'- TGTAAACAAGAAAATACTGAGCACTG -3'
(R):5'- GAGATTCCCCACTTATCATC -3'
Posted On2014-08-01