Mutagenetix > Incidental Mutation

Incidental Mutation 'R1954:Myo3a'

217533

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

039968-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1954 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22241226 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 61 (D61E)

Ref Sequence

ENSEMBL: ENSMUSP00000046329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044749
AA Change: D61E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: D61E

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142435

Predicted Effect

probably damaging
Transcript: ENSMUST00000153002
AA Change: D53E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: D53E

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Meta Mutation Damage Score

0.1762

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,566,753		probably benign	Het
Adamts15	T	A	9: 30,910,708	M478L	probably benign	Het
Akap8l	T	A	17: 32,336,736	Y123F	possibly damaging	Het
Anapc4	T	G	5: 52,846,625		probably benign	Het
Arap3	A	G	18: 37,982,002	V987A	probably damaging	Het
Atp2b4	T	A	1: 133,739,992	T105S	probably damaging	Het
Atp6v0d1	A	G	8: 105,565,893	L7P	probably damaging	Het
Atp6v1b2	T	C	8: 69,105,903	V341A	possibly damaging	Het
Baz2b	C	A	2: 59,968,743	A346S	probably benign	Het
Brpf3	G	A	17: 28,806,559	S202N	probably benign	Het
Btnl4	T	C	17: 34,472,930	K233E	possibly damaging	Het
Capn7	A	G	14: 31,360,150	T438A	probably damaging	Het
Cars2	A	T	8: 11,550,286	Y68N	probably damaging	Het
Cbx2	G	T	11: 119,028,340	G244W	probably damaging	Het
Ccr4	A	T	9: 114,492,685	V104D	probably damaging	Het
Cdc5l	T	C	17: 45,426,516		probably null	Het
Cep170	A	T	1: 176,756,384	C810S	probably benign	Het
Clp1	T	C	2: 84,724,051	D258G	probably damaging	Het
Clstn3	T	C	6: 124,459,298	E164G	possibly damaging	Het
Col28a1	T	C	6: 7,998,516	E1131G	probably damaging	Het
Cps1	A	G	1: 67,195,196	D914G	possibly damaging	Het
Ctnnal1	C	T	4: 56,817,242		probably benign	Het
Cyp2c38	A	G	19: 39,404,687	L312P	probably damaging	Het
Cytip	T	C	2: 58,148,253	N99D	possibly damaging	Het
Dennd4a	A	T	9: 64,852,467	T285S	probably benign	Het
Dhx8	A	G	11: 101,753,279	S842G	probably damaging	Het
Disp1	A	T	1: 183,088,543	M771K	probably damaging	Het
Dnah17	A	G	11: 118,024,731	I4326T	probably damaging	Het
Efcab7	T	C	4: 99,900,690	F345L	probably damaging	Het
Erc1	G	T	6: 119,797,305	Q230K	probably damaging	Het
Ern1	A	T	11: 106,421,974		probably benign	Het
Espl1	T	C	15: 102,298,388	Y96H	probably damaging	Het
Fam135a	A	T	1: 24,029,602	L533I	probably damaging	Het
Fat2	G	A	11: 55,311,084	T388I	probably benign	Het
Galnt1	T	G	18: 24,271,774		probably benign	Het
Glmn	A	G	5: 107,572,377	F212S	probably damaging	Het
Gm3604	A	T	13: 62,369,211	N444K	probably damaging	Het
Gm5434	A	G	12: 36,090,596		probably benign	Het
Gm8989	A	C	7: 106,329,681	D336E	probably damaging	Het
H2-M10.3	T	C	17: 36,367,498	D145G	probably damaging	Het
Hic2	T	A	16: 17,258,993	L562Q	probably damaging	Het
Hip1r	G	T	5: 124,001,844	E1003D	probably damaging	Het
Hist1h1c	T	C	13: 23,739,402	V185A	unknown	Het
Hist1h1d	A	G	13: 23,555,516		probably benign	Het
Hsfy2	C	T	1: 56,637,183	C65Y	probably benign	Het
Inpp1	T	C	1: 52,794,629	T103A	probably damaging	Het
Ints5	T	C	19: 8,894,896	V73A	probably damaging	Het
Iqch	A	T	9: 63,548,016	D166E	probably benign	Het
Klhdc3	A	T	17: 46,677,975	N96K	probably damaging	Het
Klk1b8	C	T	7: 43,953,848		probably benign	Het
Klrb1	T	C	6: 128,723,073		probably null	Het
Krt71	C	A	15: 101,735,466	G446*	probably null	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lemd3	G	T	10: 120,978,940	S129R	probably damaging	Het
Lrp1b	A	G	2: 40,858,441	L3015P	probably damaging	Het
Mdga2	T	C	12: 66,486,708		probably benign	Het
Mlst8	A	T	17: 24,477,221	I178N	probably damaging	Het
Mon2	A	T	10: 123,038,483	I320N	probably damaging	Het
Morc2b	T	C	17: 33,137,490	Y436C	probably damaging	Het
Moxd1	T	A	10: 24,279,883	M295K	probably benign	Het
Mrps5	T	A	2: 127,596,897		probably null	Het
Mtor	C	A	4: 148,468,273	S744R	probably damaging	Het
Nars	C	T	18: 64,500,564	R545Q	probably damaging	Het
Ncoa6	A	G	2: 155,406,821	V1521A	possibly damaging	Het
Ndor1	T	C	2: 25,255,293	E20G	possibly damaging	Het
Nipsnap3b	T	C	4: 53,017,213		probably benign	Het
Notch3	G	T	17: 32,166,678	A39E	probably benign	Het
Olfr1336	G	T	7: 6,461,145	W212L	probably benign	Het
Olfr237-ps1	T	C	6: 43,153,977	I224T	possibly damaging	Het
Olfr345	A	G	2: 36,640,215	M59V	possibly damaging	Het
Otud3	T	C	4: 138,898,032	K237R	possibly damaging	Het
Papola	T	A	12: 105,828,273		probably null	Het
Parl	T	A	16: 20,302,327	M1L	possibly damaging	Het
Parp14	G	T	16: 35,858,301	N432K	probably benign	Het
Patz1	T	G	11: 3,291,088	S159A	probably damaging	Het
Prpf6	T	G	2: 181,632,077	M338R	probably benign	Het
Psd3	A	G	8: 67,697,075	L343P	probably damaging	Het
Ptpn23	A	T	9: 110,386,325	N1422K	probably damaging	Het
Rab19	A	T	6: 39,384,082	T55S	probably benign	Het
Sh3yl1	A	G	12: 30,922,333	K34E	possibly damaging	Het
Skint8	T	A	4: 111,950,081	F321L	possibly damaging	Het
Slc25a46	A	T	18: 31,600,241		probably null	Het
Slc26a3	T	C	12: 31,450,816	L184S	probably damaging	Het
Slc39a10	A	T	1: 46,835,174	S323T	possibly damaging	Het
Sorbs2	G	T	8: 45,745,738	R20L	probably benign	Het
Stk32a	A	T	18: 43,212,025	D13V	probably benign	Het
Tab2	T	C	10: 7,919,330	T463A	probably damaging	Het
Tenm2	T	A	11: 36,047,547	N1433I	possibly damaging	Het
Tmem200c	A	T	17: 68,840,961	I180F	probably damaging	Het
Tmem232	G	T	17: 65,484,487	H129N	probably benign	Het
Tmem242	T	C	17: 5,439,579	T47A	possibly damaging	Het
Ube2d1	A	T	10: 71,285,123	M1K	probably null	Het
Uckl1	T	C	2: 181,570,527	Q332R	probably benign	Het
Unc5b	T	C	10: 60,769,265		probably benign	Het
Vmn2r114	T	C	17: 23,311,112	Y107C	probably benign	Het
Vmn2r82	A	T	10: 79,396,056	S630C	probably damaging	Het
Wdr25	T	A	12: 108,898,541	V204E	probably damaging	Het
Xab2	T	A	8: 3,616,094	D227V	probably damaging	Het
Zfp286	A	G	11: 62,783,708	S104P	possibly damaging	Het
Zfp345	T	C	2: 150,474,821	D22G	probably damaging	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- AGTGACAGAAACCTTTGAGATGC -3'
(R):5'- ATGACACTGTGGTGAGTGAG -3'

Sequencing Primer
(F):5'- ACCTTTGAGATGCTTCCATTAATTG -3'
(R):5'- TGGTGCATGCTTGAAAACCC -3'

Posted On

2014-08-01