Incidental Mutation 'R1954:Olfr237-ps1'
ID217558
Institutional Source Beutler Lab
Gene Symbol Olfr237-ps1
Ensembl Gene ENSMUSG00000094200
Gene Nameolfactory receptor 237, pseudogene 1
SynonymsGA_x6K02T2P3E9-4404793-4403861, Olfr438, MOR261-4, GA_x6K02T08UK8-1-481
MMRRC Submission 039968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1954 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43146567-43157169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43153977 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 224 (I224T)
Ref Sequence ENSEMBL: ENSMUSP00000149245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095953] [ENSMUST00000215911] [ENSMUST00000216411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095953
AA Change: I224T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093647
Gene: ENSMUSG00000094200
AA Change: I224T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8e-61 PFAM
Pfam:7tm_1 40 289 2.6e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215911
AA Change: I224T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216411
AA Change: I224T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.5065 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,566,753 probably benign Het
Adamts15 T A 9: 30,910,708 M478L probably benign Het
Akap8l T A 17: 32,336,736 Y123F possibly damaging Het
Anapc4 T G 5: 52,846,625 probably benign Het
Arap3 A G 18: 37,982,002 V987A probably damaging Het
Atp2b4 T A 1: 133,739,992 T105S probably damaging Het
Atp6v0d1 A G 8: 105,565,893 L7P probably damaging Het
Atp6v1b2 T C 8: 69,105,903 V341A possibly damaging Het
Baz2b C A 2: 59,968,743 A346S probably benign Het
Brpf3 G A 17: 28,806,559 S202N probably benign Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Capn7 A G 14: 31,360,150 T438A probably damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cbx2 G T 11: 119,028,340 G244W probably damaging Het
Ccr4 A T 9: 114,492,685 V104D probably damaging Het
Cdc5l T C 17: 45,426,516 probably null Het
Cep170 A T 1: 176,756,384 C810S probably benign Het
Clp1 T C 2: 84,724,051 D258G probably damaging Het
Clstn3 T C 6: 124,459,298 E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 E1131G probably damaging Het
Cps1 A G 1: 67,195,196 D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Cytip T C 2: 58,148,253 N99D possibly damaging Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dhx8 A G 11: 101,753,279 S842G probably damaging Het
Disp1 A T 1: 183,088,543 M771K probably damaging Het
Dnah17 A G 11: 118,024,731 I4326T probably damaging Het
Efcab7 T C 4: 99,900,690 F345L probably damaging Het
Erc1 G T 6: 119,797,305 Q230K probably damaging Het
Ern1 A T 11: 106,421,974 probably benign Het
Espl1 T C 15: 102,298,388 Y96H probably damaging Het
Fam135a A T 1: 24,029,602 L533I probably damaging Het
Fat2 G A 11: 55,311,084 T388I probably benign Het
Galnt1 T G 18: 24,271,774 probably benign Het
Glmn A G 5: 107,572,377 F212S probably damaging Het
Gm3604 A T 13: 62,369,211 N444K probably damaging Het
Gm5434 A G 12: 36,090,596 probably benign Het
Gm8989 A C 7: 106,329,681 D336E probably damaging Het
H2-M10.3 T C 17: 36,367,498 D145G probably damaging Het
Hic2 T A 16: 17,258,993 L562Q probably damaging Het
Hip1r G T 5: 124,001,844 E1003D probably damaging Het
Hist1h1c T C 13: 23,739,402 V185A unknown Het
Hist1h1d A G 13: 23,555,516 probably benign Het
Hsfy2 C T 1: 56,637,183 C65Y probably benign Het
Inpp1 T C 1: 52,794,629 T103A probably damaging Het
Ints5 T C 19: 8,894,896 V73A probably damaging Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Klhdc3 A T 17: 46,677,975 N96K probably damaging Het
Klk1b8 C T 7: 43,953,848 probably benign Het
Klrb1 T C 6: 128,723,073 probably null Het
Krt71 C A 15: 101,735,466 G446* probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lemd3 G T 10: 120,978,940 S129R probably damaging Het
Lrp1b A G 2: 40,858,441 L3015P probably damaging Het
Mdga2 T C 12: 66,486,708 probably benign Het
Mlst8 A T 17: 24,477,221 I178N probably damaging Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Moxd1 T A 10: 24,279,883 M295K probably benign Het
Mrps5 T A 2: 127,596,897 probably null Het
Mtor C A 4: 148,468,273 S744R probably damaging Het
Myo3a T A 2: 22,241,226 D61E probably damaging Het
Nars C T 18: 64,500,564 R545Q probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Ndor1 T C 2: 25,255,293 E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 probably benign Het
Notch3 G T 17: 32,166,678 A39E probably benign Het
Olfr1336 G T 7: 6,461,145 W212L probably benign Het
Olfr345 A G 2: 36,640,215 M59V possibly damaging Het
Otud3 T C 4: 138,898,032 K237R possibly damaging Het
Papola T A 12: 105,828,273 probably null Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Parp14 G T 16: 35,858,301 N432K probably benign Het
Patz1 T G 11: 3,291,088 S159A probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Psd3 A G 8: 67,697,075 L343P probably damaging Het
Ptpn23 A T 9: 110,386,325 N1422K probably damaging Het
Rab19 A T 6: 39,384,082 T55S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Skint8 T A 4: 111,950,081 F321L possibly damaging Het
Slc25a46 A T 18: 31,600,241 probably null Het
Slc26a3 T C 12: 31,450,816 L184S probably damaging Het
Slc39a10 A T 1: 46,835,174 S323T possibly damaging Het
Sorbs2 G T 8: 45,745,738 R20L probably benign Het
Stk32a A T 18: 43,212,025 D13V probably benign Het
Tab2 T C 10: 7,919,330 T463A probably damaging Het
Tenm2 T A 11: 36,047,547 N1433I possibly damaging Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmem242 T C 17: 5,439,579 T47A possibly damaging Het
Ube2d1 A T 10: 71,285,123 M1K probably null Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Unc5b T C 10: 60,769,265 probably benign Het
Vmn2r114 T C 17: 23,311,112 Y107C probably benign Het
Vmn2r82 A T 10: 79,396,056 S630C probably damaging Het
Wdr25 T A 12: 108,898,541 V204E probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Zfp286 A G 11: 62,783,708 S104P possibly damaging Het
Zfp345 T C 2: 150,474,821 D22G probably damaging Het
Other mutations in Olfr237-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr237-ps1 APN 6 43153635 missense probably damaging 1.00
IGL01658:Olfr237-ps1 APN 6 43153850 missense probably damaging 0.99
IGL02826:Olfr237-ps1 APN 6 43153577 missense possibly damaging 0.80
R0504:Olfr237-ps1 UTSW 6 43153461 missense probably benign
R0839:Olfr237-ps1 UTSW 6 43153624 missense probably benign 0.13
R5238:Olfr237-ps1 UTSW 6 43154027 missense probably damaging 1.00
R5534:Olfr237-ps1 UTSW 6 43153633 missense probably benign 0.00
R6213:Olfr237-ps1 UTSW 6 43153887 missense possibly damaging 0.95
R6382:Olfr237-ps1 UTSW 6 43153965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCCTCATGAAGTCAATC -3'
(R):5'- CCTTCAACAGTGACCTCCTGAG -3'

Sequencing Primer
(F):5'- AGTCAATCACTTCTTCTGTGAAATCC -3'
(R):5'- AGCATTCCTCAGGCTGTAGATCAG -3'
Posted On2014-08-01