Incidental Mutation 'R1954:Tab2'
ID217575
Institutional Source Beutler Lab
Gene Symbol Tab2
Ensembl Gene ENSMUSG00000015755
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms1110030N06Rik, Map3k7ip2, A530078N03Rik, Tak1 binding protein 2
MMRRC Submission 039968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1954 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7905653-7956230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7919330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 463 (T463A)
Ref Sequence ENSEMBL: ENSMUSP00000119515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130322] [ENSMUST00000146444] [ENSMUST00000147938]
Predicted Effect probably benign
Transcript: ENSMUST00000130322
SMART Domains Protein: ENSMUSP00000122559
Gene: ENSMUSG00000015755

DomainStartEndE-ValueType
low complexity region 212 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146444
AA Change: T463A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121266
Gene: ENSMUSG00000015755
AA Change: T463A

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
coiled coil region 532 619 N/A INTRINSIC
ZnF_RBZ 666 690 1.91e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147938
AA Change: T463A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119515
Gene: ENSMUSG00000015755
AA Change: T463A

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
Meta Mutation Damage Score 0.2197 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, and it thus serves as an adaptor that links MAP3K7 and TRAF6. This protein, along with TAB1 and MAP3K7, also participates in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappaB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that it functions to protect against liver damage caused by chemical stressors. Mutations in this gene cause congenital heart defects, multiple types, 2 (CHTD2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are viable up to E9.5. Embryos homozygous for a different knock-out allele are normal and viable up to E11.5 but become pale and anemic, exhibit liver hemorrhage and increased apoptosis of hepatoblasts, and die by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,566,753 probably benign Het
Adamts15 T A 9: 30,910,708 M478L probably benign Het
Akap8l T A 17: 32,336,736 Y123F possibly damaging Het
Anapc4 T G 5: 52,846,625 probably benign Het
Arap3 A G 18: 37,982,002 V987A probably damaging Het
Atp2b4 T A 1: 133,739,992 T105S probably damaging Het
Atp6v0d1 A G 8: 105,565,893 L7P probably damaging Het
Atp6v1b2 T C 8: 69,105,903 V341A possibly damaging Het
Baz2b C A 2: 59,968,743 A346S probably benign Het
Brpf3 G A 17: 28,806,559 S202N probably benign Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Capn7 A G 14: 31,360,150 T438A probably damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cbx2 G T 11: 119,028,340 G244W probably damaging Het
Ccr4 A T 9: 114,492,685 V104D probably damaging Het
Cdc5l T C 17: 45,426,516 probably null Het
Cep170 A T 1: 176,756,384 C810S probably benign Het
Clp1 T C 2: 84,724,051 D258G probably damaging Het
Clstn3 T C 6: 124,459,298 E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 E1131G probably damaging Het
Cps1 A G 1: 67,195,196 D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Cytip T C 2: 58,148,253 N99D possibly damaging Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dhx8 A G 11: 101,753,279 S842G probably damaging Het
Disp1 A T 1: 183,088,543 M771K probably damaging Het
Dnah17 A G 11: 118,024,731 I4326T probably damaging Het
Efcab7 T C 4: 99,900,690 F345L probably damaging Het
Erc1 G T 6: 119,797,305 Q230K probably damaging Het
Ern1 A T 11: 106,421,974 probably benign Het
Espl1 T C 15: 102,298,388 Y96H probably damaging Het
Fam135a A T 1: 24,029,602 L533I probably damaging Het
Fat2 G A 11: 55,311,084 T388I probably benign Het
Galnt1 T G 18: 24,271,774 probably benign Het
Glmn A G 5: 107,572,377 F212S probably damaging Het
Gm3604 A T 13: 62,369,211 N444K probably damaging Het
Gm5434 A G 12: 36,090,596 probably benign Het
Gm8989 A C 7: 106,329,681 D336E probably damaging Het
H2-M10.3 T C 17: 36,367,498 D145G probably damaging Het
Hic2 T A 16: 17,258,993 L562Q probably damaging Het
Hip1r G T 5: 124,001,844 E1003D probably damaging Het
Hist1h1c T C 13: 23,739,402 V185A unknown Het
Hist1h1d A G 13: 23,555,516 probably benign Het
Hsfy2 C T 1: 56,637,183 C65Y probably benign Het
Inpp1 T C 1: 52,794,629 T103A probably damaging Het
Ints5 T C 19: 8,894,896 V73A probably damaging Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Klhdc3 A T 17: 46,677,975 N96K probably damaging Het
Klk1b8 C T 7: 43,953,848 probably benign Het
Klrb1 T C 6: 128,723,073 probably null Het
Krt71 C A 15: 101,735,466 G446* probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lemd3 G T 10: 120,978,940 S129R probably damaging Het
Lrp1b A G 2: 40,858,441 L3015P probably damaging Het
Mdga2 T C 12: 66,486,708 probably benign Het
Mlst8 A T 17: 24,477,221 I178N probably damaging Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Moxd1 T A 10: 24,279,883 M295K probably benign Het
Mrps5 T A 2: 127,596,897 probably null Het
Mtor C A 4: 148,468,273 S744R probably damaging Het
Myo3a T A 2: 22,241,226 D61E probably damaging Het
Nars C T 18: 64,500,564 R545Q probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Ndor1 T C 2: 25,255,293 E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 probably benign Het
Notch3 G T 17: 32,166,678 A39E probably benign Het
Olfr1336 G T 7: 6,461,145 W212L probably benign Het
Olfr237-ps1 T C 6: 43,153,977 I224T possibly damaging Het
Olfr345 A G 2: 36,640,215 M59V possibly damaging Het
Otud3 T C 4: 138,898,032 K237R possibly damaging Het
Papola T A 12: 105,828,273 probably null Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Parp14 G T 16: 35,858,301 N432K probably benign Het
Patz1 T G 11: 3,291,088 S159A probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Psd3 A G 8: 67,697,075 L343P probably damaging Het
Ptpn23 A T 9: 110,386,325 N1422K probably damaging Het
Rab19 A T 6: 39,384,082 T55S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Skint8 T A 4: 111,950,081 F321L possibly damaging Het
Slc25a46 A T 18: 31,600,241 probably null Het
Slc26a3 T C 12: 31,450,816 L184S probably damaging Het
Slc39a10 A T 1: 46,835,174 S323T possibly damaging Het
Sorbs2 G T 8: 45,745,738 R20L probably benign Het
Stk32a A T 18: 43,212,025 D13V probably benign Het
Tenm2 T A 11: 36,047,547 N1433I possibly damaging Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmem242 T C 17: 5,439,579 T47A possibly damaging Het
Ube2d1 A T 10: 71,285,123 M1K probably null Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Unc5b T C 10: 60,769,265 probably benign Het
Vmn2r114 T C 17: 23,311,112 Y107C probably benign Het
Vmn2r82 A T 10: 79,396,056 S630C probably damaging Het
Wdr25 T A 12: 108,898,541 V204E probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Zfp286 A G 11: 62,783,708 S104P possibly damaging Het
Zfp345 T C 2: 150,474,821 D22G probably damaging Het
Other mutations in Tab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Tab2 APN 10 7910073 missense probably benign 0.21
IGL01316:Tab2 APN 10 7924704 missense probably damaging 1.00
IGL01902:Tab2 APN 10 7919992 missense probably benign 0.12
IGL03338:Tab2 APN 10 7919275 missense probably damaging 1.00
Cosmo UTSW 10 7924719 missense probably damaging 1.00
Cosmo-2 UTSW 10 7907481 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0271:Tab2 UTSW 10 7919158 missense probably benign
R0458:Tab2 UTSW 10 7919555 missense probably damaging 1.00
R0608:Tab2 UTSW 10 7920119 missense probably damaging 0.99
R0632:Tab2 UTSW 10 7919801 missense probably benign 0.07
R0744:Tab2 UTSW 10 7907581 unclassified probably benign
R1162:Tab2 UTSW 10 7924719 missense probably damaging 1.00
R1424:Tab2 UTSW 10 7920048 missense possibly damaging 0.86
R2516:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2518:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2520:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R3418:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R4081:Tab2 UTSW 10 7919831 missense probably damaging 1.00
R4177:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R4178:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R5410:Tab2 UTSW 10 7919821 missense possibly damaging 0.86
R5681:Tab2 UTSW 10 7920073 missense probably damaging 1.00
R5683:Tab2 UTSW 10 7919112 critical splice donor site probably null
R6857:Tab2 UTSW 10 7920413 missense possibly damaging 0.50
R7424:Tab2 UTSW 10 7907483 missense probably damaging 1.00
R7692:Tab2 UTSW 10 7911105 missense probably damaging 1.00
R7790:Tab2 UTSW 10 7920424 missense probably damaging 1.00
R7792:Tab2 UTSW 10 7919133 missense possibly damaging 0.50
Z1088:Tab2 UTSW 10 7920266 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGGCAGCATCATCAGATCCC -3'
(R):5'- CAAGGCATGCGGAATCAACC -3'

Sequencing Primer
(F):5'- AGATCCCATACTCAGTTTCCGGG -3'
(R):5'- GGAATCAACCGACACTCTTCATATC -3'
Posted On2014-08-01