Incidental Mutation 'R0133:Olfr829'
ID21758
Institutional Source Beutler Lab
Gene Symbol Olfr829
Ensembl Gene ENSMUSG00000051414
Gene Nameolfactory receptor 829
SynonymsGA_x6K02T2PVTD-12599710-12600648, MOR147-1
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R0133 (G1)
Quality Score181
Status Validated (trace)
Chromosome9
Chromosomal Location18854933-18859080 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 18856629 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000058101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058411] [ENSMUST00000212229]
Predicted Effect probably null
Transcript: ENSMUST00000058411
AA Change: M1I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058101
Gene: ENSMUSG00000051414
AA Change: M1I

DomainStartEndE-ValueType
Pfam:7tm_4 40 317 2e-52 PFAM
Pfam:7TM_GPCR_Srsx 44 174 1e-10 PFAM
Pfam:7tm_1 50 299 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212229
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Olfr829
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Olfr829 APN 9 18857534 missense probably damaging 0.97
IGL01696:Olfr829 APN 9 18857056 missense probably benign 0.19
IGL02285:Olfr829 APN 9 18856990 missense possibly damaging 0.87
R0173:Olfr829 UTSW 9 18857029 missense probably damaging 0.98
R0270:Olfr829 UTSW 9 18856831 missense probably damaging 1.00
R0449:Olfr829 UTSW 9 18856649 missense probably benign 0.00
R1111:Olfr829 UTSW 9 18857592 makesense probably null
R1462:Olfr829 UTSW 9 18857111 missense probably benign 0.30
R1462:Olfr829 UTSW 9 18857111 missense probably benign 0.30
R1845:Olfr829 UTSW 9 18857486 missense possibly damaging 0.95
R4090:Olfr829 UTSW 9 18857102 missense probably benign 0.00
R4096:Olfr829 UTSW 9 18856637 missense probably benign
R4097:Olfr829 UTSW 9 18856637 missense probably benign
R4755:Olfr829 UTSW 9 18857180 missense probably benign 0.03
R4867:Olfr829 UTSW 9 18857566 missense probably benign 0.00
R5084:Olfr829 UTSW 9 18857336 missense probably benign 0.43
R7216:Olfr829 UTSW 9 18857336 missense probably benign 0.43
R7252:Olfr829 UTSW 9 18857252 missense probably damaging 1.00
R7300:Olfr829 UTSW 9 18857234 missense not run
R7412:Olfr829 UTSW 9 18856789 missense possibly damaging 0.51
X0024:Olfr829 UTSW 9 18857024 missense probably damaging 1.00
X0057:Olfr829 UTSW 9 18856637 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGTTCtctctgcctctgtgtct -3'
(R):5'- CCTCCATAAGTGATGTTCTGGTTTCCTG -3'

Sequencing Primer
(F):5'- ctgccttgtcttcttatgctg -3'
(R):5'- CACCAGCATCTTTGGAATAGTG -3'
Posted On2013-04-12